EMAIL THIS PAGE TO A FRIEND

ERVFRD-1

endogenous retrovirus group FRD, member 1

31 Gene Product Result for
Synonyms: ERVFRDE1 GLLL6191 HERV-FRD HERV-W/FRD UNQ6191 envFRD
UniProtKB ID: P60508
Gene ID:
Human(405754) Summary: Many different human endogenous retrovirus (HERV) families are expressed in normal placental tissue at high levels, suggesting that HERVs are functionally important in reproduction. This gene is part of a human endogenous retrovirus provirus on chromosome 6 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product plays a major role in placental development and trophoblast fusion. The protein has the characteristics of a typical retroviral envelope protein, including a cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. [provided by RefSeq, Jun 2012]
Rat(290348) endogenous retrovirus group FRD, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207582 Rosetta Predictions human pricing
NM_001024239 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140921 predicted 613
2 SASI_Hs01_00140922 predicted 418
3 SASI_Hs01_00140923 predicted 566
4 SASI_Hs01_00140924 predicted 450
5 SASI_Hs01_00140925 predicted 785
6 SASI_Hs01_00140926 predicted 619
7 SASI_Hs01_00140927 predicted 800
8 SASI_Hs01_00140928 predicted 560
9 SASI_Hs01_00140929 predicted 387
10 SASI_Hs01_00140930 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113198 predicted 1388
2 SASI_Rn01_00113199 predicted 629
3 SASI_Rn02_00202385 predicted 1376
4 SASI_Rn01_00113200 predicted 296
5 SASI_Rn01_00113202 predicted 563
6 SASI_Rn01_00113203 predicted 1112
7 SASI_Rn02_00202386 predicted 718
8 SASI_Rn01_00113204 predicted 250
9 SASI_Rn01_00113206 predicted 215
10 SASI_Rn02_00202387 predicted 1228
11 SASI_Rn01_00113201 predicted 1054
12 SASI_Rn01_00113205 predicted 367
13 SASI_Rn01_00113207 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207582
ERVFRD-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group FRD, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-578s1c1
Sequence:CCGGGCGGAATTACATATTTCCTATCTCGAGATAGGAAATATGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-700s1c1
Sequence:CCGGCGGACCCATCTTTACTAATATCTCGAGATATTAGTAAAGATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1576s1c1
Sequence:CCGGGCAAGAACAAATCGACTCTTTCTCGAGAAAGAGTCGATTTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1919s1c1
Sequence:CCGGGCCATAAAGCTCCAGACGAATCTCGAGATTCGTCTGGAGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-423s1c1
Sequence:CCGGGCCATCCTGATTTCCCGTTATCTCGAGATAACGGGAAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207582
ERVFRD-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group FRD, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-578s1c1
Sequence:CCGGGCGGAATTACATATTTCCTATCTCGAGATAGGAAATATGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-700s1c1
Sequence:CCGGCGGACCCATCTTTACTAATATCTCGAGATATTAGTAAAGATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1576s1c1
Sequence:CCGGGCAAGAACAAATCGACTCTTTCTCGAGAAAGAGTCGATTTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1919s1c1
Sequence:CCGGGCCATAAAGCTCCAGACGAATCTCGAGATTCGTCTGGAGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-423s1c1
Sequence:CCGGGCCATCCTGATTTCCCGTTATCTCGAGATAACGGGAAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207582
ERVFRD-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group FRD, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-578s1c1
Sequence:CCGGGCGGAATTACATATTTCCTATCTCGAGATAGGAAATATGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-700s1c1
Sequence:CCGGCGGACCCATCTTTACTAATATCTCGAGATATTAGTAAAGATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1576s1c1
Sequence:CCGGGCAAGAACAAATCGACTCTTTCTCGAGAAAGAGTCGATTTGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-1919s1c1
Sequence:CCGGGCCATAAAGCTCCAGACGAATCTCGAGATTCGTCTGGAGCTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207582.1-423s1c1
Sequence:CCGGGCCATCCTGATTTCCCGTTATCTCGAGATAACGGGAAATCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks