EMAIL THIS PAGE TO A FRIEND

ERVFRD-2

endogenous retrovirus group FRD, member 2

Gene Product Result for
Species: Human ERVFRD-2(388560)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207394
ERVFRD-2 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group FRD, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207394.1-2068s1c1
Sequence:CCGGCCCATGACATTGCTGAATTATCTCGAGATAATTCAGCAATGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-663s1c1
Sequence:CCGGCCTCCTTGTATCGCACTCTTACTCGAGTAAGAGTGCGATACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-519s1c1
Sequence:CCGGGCAAGATAGATCCTGCCCTTTCTCGAGAAAGGGCAGGATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-874s1c1
Sequence:CCGGCCGTAAATTAACCCTCACTTTCTCGAGAAAGTGAGGGTTAATTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-1216s1c1
Sequence:CCGGGCTCCAGGAAACTCTTATCAACTCGAGTTGATAAGAGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207394
ERVFRD-2 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group FRD, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207394.1-2068s1c1
Sequence:CCGGCCCATGACATTGCTGAATTATCTCGAGATAATTCAGCAATGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-663s1c1
Sequence:CCGGCCTCCTTGTATCGCACTCTTACTCGAGTAAGAGTGCGATACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-519s1c1
Sequence:CCGGGCAAGATAGATCCTGCCCTTTCTCGAGAAAGGGCAGGATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-874s1c1
Sequence:CCGGCCGTAAATTAACCCTCACTTTCTCGAGAAAGTGAGGGTTAATTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-1216s1c1
Sequence:CCGGGCTCCAGGAAACTCTTATCAACTCGAGTTGATAAGAGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207394
ERVFRD-2 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group FRD, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207394.1-2068s1c1
Sequence:CCGGCCCATGACATTGCTGAATTATCTCGAGATAATTCAGCAATGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-663s1c1
Sequence:CCGGCCTCCTTGTATCGCACTCTTACTCGAGTAAGAGTGCGATACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-519s1c1
Sequence:CCGGGCAAGATAGATCCTGCCCTTTCTCGAGAAAGGGCAGGATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-874s1c1
Sequence:CCGGCCGTAAATTAACCCTCACTTTCTCGAGAAAGTGAGGGTTAATTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207394.1-1216s1c1
Sequence:CCGGGCTCCAGGAAACTCTTATCAACTCGAGTTGATAAGAGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks