EMAIL THIS PAGE TO A FRIEND

ERVK-6

endogenous retrovirus group K, member 6

Gene Product Result for
Synonyms: ERVK6 HERV-K(C7) HERV-K108 K-Rev c-orf cORF
Species: Human ERVK-6(64006)
UniProtKB ID: Q69383
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007236
ERVK-6 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group K, member 6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000152003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-568s1c1
Sequence:CCGGCCTGTAACATTACAACCTCAACTCGAGTTGAGGTTGTAATGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-4210s1c1
Sequence:CCGGCCGAAAGAACGAGTAATCAAACTCGAGTTTGATTACTCGTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-268s1c1
Sequence:CCGGGCAGCTTTAGAACCATTTCAACTCGAGTTGAAATGGTTCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-37s1c1
Sequence:CCGGGCCTCTTATCTCAGCTTTATTCTCGAGAATAAAGCTGAGATAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007236
ERVK-6 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group K, member 6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000152003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-568s1c1
Sequence:CCGGCCTGTAACATTACAACCTCAACTCGAGTTGAGGTTGTAATGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-4210s1c1
Sequence:CCGGCCGAAAGAACGAGTAATCAAACTCGAGTTTGATTACTCGTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-268s1c1
Sequence:CCGGGCAGCTTTAGAACCATTTCAACTCGAGTTGAAATGGTTCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-37s1c1
Sequence:CCGGGCCTCTTATCTCAGCTTTATTCTCGAGAATAAAGCTGAGATAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007236
ERVK-6 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group K, member 6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000152003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-568s1c1
Sequence:CCGGCCTGTAACATTACAACCTCAACTCGAGTTGAGGTTGTAATGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-4210s1c1
Sequence:CCGGCCGAAAGAACGAGTAATCAAACTCGAGTTTGATTACTCGTTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-268s1c1
Sequence:CCGGGCAGCTTTAGAACCATTTCAACTCGAGTTGAAATGGTTCTAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007236.1-37s1c1
Sequence:CCGGGCCTCTTATCTCAGCTTTATTCTCGAGAATAAAGCTGAGATAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks