EMAIL THIS PAGE TO A FRIEND

ERVMER61-1

endogenous retrovirus group MER61, member 1

Synonyms: C1orf99 RP11-393M18.3
Species: Human ERVMER61-1(339476)
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012274
ERVMER61-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group MER61, member 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-333s1c1
Sequence:CCGGGCATAAGAATAAGAGGTTCTTCTCGAGAAGAACCTCTTATTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-345s1c1
Sequence:CCGGGAGGTTCTTCCACAGGCATTTCTCGAGAAATGCCTGTGGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012274
ERVMER61-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group MER61, member 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-333s1c1
Sequence:CCGGGCATAAGAATAAGAGGTTCTTCTCGAGAAGAACCTCTTATTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-345s1c1
Sequence:CCGGGAGGTTCTTCCACAGGCATTTCTCGAGAAATGCCTGTGGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012274
ERVMER61-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group MER61, member 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-333s1c1
Sequence:CCGGGCATAAGAATAAGAGGTTCTTCTCGAGAAGAACCTCTTATTCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012274.1-345s1c1
Sequence:CCGGGAGGTTCTTCCACAGGCATTTCTCGAGAAATGCCTGTGGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks