EMAIL THIS PAGE TO A FRIEND

ERVV-1

endogenous retrovirus group V, member 1

34 Gene Product Result for
Synonyms: ENVV1 ERVV-2 HERV-V1
Species: Human ERVV-1(147664)
UniProtKB ID: B6SEH8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152473 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063363 predicted 1608
2 SASI_Hs01_00063364 predicted 535
3 SASI_Hs01_00063365 predicted 601
4 SASI_Hs01_00063366 predicted 571
5 SASI_Hs01_00063367 predicted 531
6 SASI_Hs01_00063368 predicted 1623
7 SASI_Hs01_00063369 predicted 1230
8 SASI_Hs01_00063370 predicted 561
9 SASI_Hs01_00063371 predicted 529
10 SASI_Hs01_00063372 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152473
ERVV-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group V, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-928s1c1
Sequence:CCGGGATCAGTAAATCCTGTTGCATCTCGAGATGCAACAGGATTTACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-1112s1c1
Sequence:CCGGGCTGCACTTAATAGCCTGCTTCTCGAGAAGCAGGCTATTAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-567s1c1
Sequence:CCGGCAAACCTCTACACTTGCATTACTCGAGTAATGCAAGTGTAGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152473.1-810s1c1
Sequence:CCGGGTACCAGAGATAGCATCTCTACTCGAGTAGAGATGCTATCTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-522s1c1
Sequence:CCGGCCTTTGATGGAAGTCCTAAGACTCGAGTCTTAGGACTTCCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152473
ERVV-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group V, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-928s1c1
Sequence:CCGGGATCAGTAAATCCTGTTGCATCTCGAGATGCAACAGGATTTACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-1112s1c1
Sequence:CCGGGCTGCACTTAATAGCCTGCTTCTCGAGAAGCAGGCTATTAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-567s1c1
Sequence:CCGGCAAACCTCTACACTTGCATTACTCGAGTAATGCAAGTGTAGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152473.1-810s1c1
Sequence:CCGGGTACCAGAGATAGCATCTCTACTCGAGTAGAGATGCTATCTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-522s1c1
Sequence:CCGGCCTTTGATGGAAGTCCTAAGACTCGAGTCTTAGGACTTCCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152473
ERVV-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group V, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-928s1c1
Sequence:CCGGGATCAGTAAATCCTGTTGCATCTCGAGATGCAACAGGATTTACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-1112s1c1
Sequence:CCGGGCTGCACTTAATAGCCTGCTTCTCGAGAAGCAGGCTATTAAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-567s1c1
Sequence:CCGGCAAACCTCTACACTTGCATTACTCGAGTAATGCAAGTGTAGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152473.1-810s1c1
Sequence:CCGGGTACCAGAGATAGCATCTCTACTCGAGTAGAGATGCTATCTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152473.1-522s1c1
Sequence:CCGGCCTTTGATGGAAGTCCTAAGACTCGAGTCTTAGGACTTCCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks