EMAIL THIS PAGE TO A FRIEND

ERVW-1

endogenous retrovirus group W, member 1

6 Gene Product Result for
Synonyms: ENV ENVW ERVWE1 HERV-7q HERV-W-ENV HERV7Q HERVW HERVWENV
Species: Human ERVW-1(30816)
Gene ID:
Human(30816) Summary: Many different human endogenous retrovirus (HERV) families are expressed in normal placental tissue at high levels, suggesting that HERVs are functionally important in reproduction. This gene is part of an HERV provirus on chromosome 7 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product is expressed in the placental syncytiotrophoblast and is involved in fusion of the cytotrophoblast cells to form the syncytial layer of the placenta. The protein has the characteristics of a typical retroviral envelope protein, including a furin cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014590 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107361 MISSION® esiRNA esiRNA human ERVWE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014590
ERVW-1 MISSION shRNA Bacterial Glycerol Stock
endogenous retrovirus group W, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014590.3-2832s1c1
Sequence:CCGGCCAATCAGAGAGCTCACTAAACTCGAGTTTAGTGAGCTCTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-2439s1c1
Sequence:CCGGCCCTGTATCTTTAACCTCCTTCTCGAGAAGGAGGTTAAAGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1815s1c1
Sequence:CCGGCCCACACAAATAGTCTGCCTACTCGAGTAGGCAGACTATTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1530s1c1
Sequence:CCGGCGCCTGGTAAGCCTATTTAATCTCGAGATTAAATAGGCTTACCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1672s1c1
Sequence:CCGGGCACAGAAATAAACACCACTTCTCGAGAAGTGGTGTTTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1162s21c1
Sequence:CCGGGAATGCAGCGTCCCGGAAATACTCGAGTATTTCCGGGACGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2141s21c1
Sequence:CCGGCACCTTGCAAGATCAACTTAACTCGAGTTAAGTTGATCTTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2399s21c1
Sequence:CCGGAGGACCTCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1863s21c1
Sequence:CCGGACCTCAGCCTATCGTTGTTTGCTCGAGCAAACAACGATAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014590
ERVW-1 MISSION shRNA shRNA Plasmid DNA
endogenous retrovirus group W, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014590.3-2832s1c1
Sequence:CCGGCCAATCAGAGAGCTCACTAAACTCGAGTTTAGTGAGCTCTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-2439s1c1
Sequence:CCGGCCCTGTATCTTTAACCTCCTTCTCGAGAAGGAGGTTAAAGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1815s1c1
Sequence:CCGGCCCACACAAATAGTCTGCCTACTCGAGTAGGCAGACTATTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1530s1c1
Sequence:CCGGCGCCTGGTAAGCCTATTTAATCTCGAGATTAAATAGGCTTACCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1672s1c1
Sequence:CCGGGCACAGAAATAAACACCACTTCTCGAGAAGTGGTGTTTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1162s21c1
Sequence:CCGGGAATGCAGCGTCCCGGAAATACTCGAGTATTTCCGGGACGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2141s21c1
Sequence:CCGGCACCTTGCAAGATCAACTTAACTCGAGTTAAGTTGATCTTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2399s21c1
Sequence:CCGGAGGACCTCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1863s21c1
Sequence:CCGGACCTCAGCCTATCGTTGTTTGCTCGAGCAAACAACGATAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014590
ERVW-1 MISSION shRNA Lentiviral Transduction Particles
endogenous retrovirus group W, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014590.3-2832s1c1
Sequence:CCGGCCAATCAGAGAGCTCACTAAACTCGAGTTTAGTGAGCTCTCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-2439s1c1
Sequence:CCGGCCCTGTATCTTTAACCTCCTTCTCGAGAAGGAGGTTAAAGATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1815s1c1
Sequence:CCGGCCCACACAAATAGTCTGCCTACTCGAGTAGGCAGACTATTTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1530s1c1
Sequence:CCGGCGCCTGGTAAGCCTATTTAATCTCGAGATTAAATAGGCTTACCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014590.3-1672s1c1
Sequence:CCGGGCACAGAAATAAACACCACTTCTCGAGAAGTGGTGTTTATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1162s21c1
Sequence:CCGGGAATGCAGCGTCCCGGAAATACTCGAGTATTTCCGGGACGCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2141s21c1
Sequence:CCGGCACCTTGCAAGATCAACTTAACTCGAGTTAAGTTGATCTTGCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-2399s21c1
Sequence:CCGGAGGACCTCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014590.3-1863s21c1
Sequence:CCGGACCTCAGCCTATCGTTGTTTGCTCGAGCAAACAACGATAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks