EMAIL THIS PAGE TO A FRIEND

ESAM

endothelial cell adhesion molecule

82 Gene Product Result for
Synonyms: W117m
UniProtKB ID: Q96AP7, Q96T50
Gene ID:
Mouse(69524) endothelial cell-specific adhesion molecule
Rat(300519) endothelial cell adhesion molecule
chicken(419707) endothelial cell adhesion molecule
domestic cat(101081329) endothelial cell adhesion molecule
cow(616926) endothelial cell adhesion molecule
dog(489309) endothelial cell adhesion molecule
sheep(101108435) endothelial cell adhesion molecule
domestic guinea pig(100722089) endothelial cell adhesion molecule
naked mole-rat(101719988) endothelial cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1444 Human ESAM ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138961 Rosetta Predictions human pricing
NM_001004245 Rosetta Predictions rat pricing
NM_027102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117618 predicted 1592
2 SASI_Hs01_00117619 predicted 754
3 SASI_Hs01_00117620 predicted 1469
4 SASI_Hs01_00117621 predicted 551
5 SASI_Hs01_00117622 predicted 698
6 SASI_Hs01_00117623 predicted 739
7 SASI_Hs01_00117624 predicted 696
8 SASI_Hs01_00117625 predicted 1487
9 SASI_Hs02_00364012 predicted 460
10 SASI_Hs01_00117626 predicted 1389
11 SASI_Hs01_00117627 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036305 predicted 621
2 SASI_Rn01_00036306 predicted 1053
3 SASI_Rn01_00036308 predicted 1283
4 SASI_Rn01_00036309 predicted 1351
5 SASI_Rn01_00036310 predicted 1361
6 SASI_Rn01_00036311 predicted 1268
7 SASI_Rn01_00036312 predicted 1227
8 SASI_Rn01_00036313 predicted 1297
9 SASI_Rn01_00036314 predicted 690
10 SASI_Rn02_00198259 predicted 938
11 SASI_Rn01_00036307 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128238 predicted 753
2 SASI_Mm01_00128240 predicted 1305
3 SASI_Mm01_00128241 predicted 727
4 SASI_Mm01_00128242 predicted 426
5 SASI_Mm01_00128243 predicted 485
6 SASI_Mm02_00331541 predicted 655
7 SASI_Mm01_00128244 predicted 529
8 SASI_Mm01_00128245 predicted 594
9 SASI_Mm01_00128246 predicted 358
10 SASI_Mm01_00128247 predicted 1296
11 SASI_Mm01_00128239 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027102
VALIDATED
ESAM MISSION shRNA Bacterial Glycerol Stock
endothelial cell adhesion molecule
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-733s21c1
Sequence:CCGGGATGCTGTTCGTGGATCTTTACTCGAGTAAAGATCCACGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1103s21c1
Sequence:CCGGCTCCAAGACCTGGCACATTTACTCGAGTAAATGTGCCAGGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-372s21c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1300s21c1
Sequence:CCGGTGATAGCCCAGGCACTCATTACTCGAGTAATGAGTGCCTGGGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.2-1640s21c1
Sequence:CCGGTGTACAACACCCTTATCTAATCTCGAGATTAGATAAGGGTGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.3-1651s21c1
Sequence:CCGGGATCTGTACAACACCCTTATCCTCGAGGATAAGGGTGTTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-601s21c1
Sequence:CCGGGCTCCTCCATCCTGTAGTTTACTCGAGTAAACTACAGGATGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-975s21c1
Sequence:CCGGGGAAGAGCTGGCCAATGATATCTCGAGATATCATTGGCCAGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-970s1c1
Sequence:CCGGGCCAATGATATCAAGGAAGATCTCGAGATCTTCCTTGATATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027102.1-1424s1c1
Sequence:CCGGCCTCCTTCTATTGTTGGAATACTCGAGTATTCCAACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-372s1c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-429s1c1
Sequence:CCGGCCACTCTATCTCTTCACGGAACTCGAGTTCCGTGAAGAGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-232s1c1
Sequence:CCGGCTCAACAAATTGGAAGCGGTACTCGAGTACCGCTTCCAATTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027102
VALIDATED
ESAM MISSION shRNA shRNA Plasmid DNA
endothelial cell adhesion molecule
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-733s21c1
Sequence:CCGGGATGCTGTTCGTGGATCTTTACTCGAGTAAAGATCCACGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1103s21c1
Sequence:CCGGCTCCAAGACCTGGCACATTTACTCGAGTAAATGTGCCAGGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-372s21c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1300s21c1
Sequence:CCGGTGATAGCCCAGGCACTCATTACTCGAGTAATGAGTGCCTGGGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.2-1640s21c1
Sequence:CCGGTGTACAACACCCTTATCTAATCTCGAGATTAGATAAGGGTGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.3-1651s21c1
Sequence:CCGGGATCTGTACAACACCCTTATCCTCGAGGATAAGGGTGTTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-601s21c1
Sequence:CCGGGCTCCTCCATCCTGTAGTTTACTCGAGTAAACTACAGGATGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-975s21c1
Sequence:CCGGGGAAGAGCTGGCCAATGATATCTCGAGATATCATTGGCCAGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-970s1c1
Sequence:CCGGGCCAATGATATCAAGGAAGATCTCGAGATCTTCCTTGATATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027102.1-1424s1c1
Sequence:CCGGCCTCCTTCTATTGTTGGAATACTCGAGTATTCCAACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-372s1c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-429s1c1
Sequence:CCGGCCACTCTATCTCTTCACGGAACTCGAGTTCCGTGAAGAGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-232s1c1
Sequence:CCGGCTCAACAAATTGGAAGCGGTACTCGAGTACCGCTTCCAATTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027102
VALIDATED
ESAM MISSION shRNA Lentiviral Transduction Particles
endothelial cell adhesion molecule
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-733s21c1
Sequence:CCGGGATGCTGTTCGTGGATCTTTACTCGAGTAAAGATCCACGAACAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1103s21c1
Sequence:CCGGCTCCAAGACCTGGCACATTTACTCGAGTAAATGTGCCAGGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-372s21c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.2-1300s21c1
Sequence:CCGGTGATAGCCCAGGCACTCATTACTCGAGTAATGAGTGCCTGGGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.2-1640s21c1
Sequence:CCGGTGTACAACACCCTTATCTAATCTCGAGATTAGATAAGGGTGTTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027102.3-1651s21c1
Sequence:CCGGGATCTGTACAACACCCTTATCCTCGAGGATAAGGGTGTTGTACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-601s21c1
Sequence:CCGGGCTCCTCCATCCTGTAGTTTACTCGAGTAAACTACAGGATGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027102.3-975s21c1
Sequence:CCGGGGAAGAGCTGGCCAATGATATCTCGAGATATCATTGGCCAGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-970s1c1
Sequence:CCGGGCCAATGATATCAAGGAAGATCTCGAGATCTTCCTTGATATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027102.1-1424s1c1
Sequence:CCGGCCTCCTTCTATTGTTGGAATACTCGAGTATTCCAACAATAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027102.1-372s1c1
Sequence:CCGGCCAGGTGTTGTCTTACATTAACTCGAGTTAATGTAAGACAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-429s1c1
Sequence:CCGGCCACTCTATCTCTTCACGGAACTCGAGTTCCGTGAAGAGATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027102.1-232s1c1
Sequence:CCGGCTCAACAAATTGGAAGCGGTACTCGAGTACCGCTTCCAATTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138961
ESAM MISSION shRNA Bacterial Glycerol Stock
endothelial cell adhesion molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-837s1c1
Sequence:CCGGCCAATGTAATGTGACGCTGGACTCGAGTCCAGCGTCACATTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-1320s1c1
Sequence:CCGGCCACTCATTGGCTAAAGGATTCTCGAGAATCCTTTAGCCAATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-988s1c1
Sequence:CCGGGATATCAAGGAGGATGCCATTCTCGAGAATGGCATCCTCCTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-351s1c1
Sequence:CCGGGATGTGGTTCTTCAAACAGAACTCGAGTTCTGTTTGAAGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-526s1c1
Sequence:CCGGGTGCAAGACAAACAAGGCAAACTCGAGTTTGCCTTGTTTGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-838s1c1
Sequence:CCGGCAATGTAATGTGACGCTGGAACTCGAGTTCCAGCGTCACATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-712s1c1
Sequence:CCGGCCATCCTTCCAGACTTTCTTTCTCGAGAAAGAAAGTCTGGAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-413s1c1
Sequence:CCGGCAACAAGCAAACCTGGAGTATCTCGAGATACTCCAGGTTTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138961.1-1494s1c1
Sequence:CCGGGAAGAGGAAGTGGATCTGGAACTCGAGTTCCAGATCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138961
ESAM MISSION shRNA shRNA Plasmid DNA
endothelial cell adhesion molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-837s1c1
Sequence:CCGGCCAATGTAATGTGACGCTGGACTCGAGTCCAGCGTCACATTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-1320s1c1
Sequence:CCGGCCACTCATTGGCTAAAGGATTCTCGAGAATCCTTTAGCCAATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-988s1c1
Sequence:CCGGGATATCAAGGAGGATGCCATTCTCGAGAATGGCATCCTCCTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-351s1c1
Sequence:CCGGGATGTGGTTCTTCAAACAGAACTCGAGTTCTGTTTGAAGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-526s1c1
Sequence:CCGGGTGCAAGACAAACAAGGCAAACTCGAGTTTGCCTTGTTTGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-838s1c1
Sequence:CCGGCAATGTAATGTGACGCTGGAACTCGAGTTCCAGCGTCACATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-712s1c1
Sequence:CCGGCCATCCTTCCAGACTTTCTTTCTCGAGAAAGAAAGTCTGGAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-413s1c1
Sequence:CCGGCAACAAGCAAACCTGGAGTATCTCGAGATACTCCAGGTTTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138961.1-1494s1c1
Sequence:CCGGGAAGAGGAAGTGGATCTGGAACTCGAGTTCCAGATCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138961
ESAM MISSION shRNA Lentiviral Transduction Particles
endothelial cell adhesion molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-837s1c1
Sequence:CCGGCCAATGTAATGTGACGCTGGACTCGAGTCCAGCGTCACATTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-1320s1c1
Sequence:CCGGCCACTCATTGGCTAAAGGATTCTCGAGAATCCTTTAGCCAATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-988s1c1
Sequence:CCGGGATATCAAGGAGGATGCCATTCTCGAGAATGGCATCCTCCTTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-351s1c1
Sequence:CCGGGATGTGGTTCTTCAAACAGAACTCGAGTTCTGTTTGAAGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-526s1c1
Sequence:CCGGGTGCAAGACAAACAAGGCAAACTCGAGTTTGCCTTGTTTGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-838s1c1
Sequence:CCGGCAATGTAATGTGACGCTGGAACTCGAGTTCCAGCGTCACATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-712s1c1
Sequence:CCGGCCATCCTTCCAGACTTTCTTTCTCGAGAAAGAAAGTCTGGAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138961.1-413s1c1
Sequence:CCGGCAACAAGCAAACCTGGAGTATCTCGAGATACTCCAGGTTTGCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138961.1-1494s1c1
Sequence:CCGGGAAGAGGAAGTGGATCTGGAACTCGAGTTCCAGATCCACTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks