EMAIL THIS PAGE TO A FRIEND

ESCO1

establishment of sister chromatid cohesion N-acetyltransferase 1

148 Gene Product Result for
Synonyms: A930014I12Rik CTF ECO1 EFO1 ESO1
Gene ID:
Human(114799) Summary: ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]
Mouse(77805) establishment of cohesion 1 homolog 1 (S. cerevisiae)
Rat(680014) establishment of cohesion 1 homolog 1 (S. cerevisiae)
chicken(421067) establishment of cohesion 1 homolog 1 (S. cerevisiae)
domestic cat(101093305) establishment of cohesion 1 homolog 1 (S. cerevisiae)
Horse(100060473) establishment of cohesion 1 homolog 1 (S. cerevisiae)
cow(535035) establishment of sister chromatid cohesion N-acetyltransferase 1
dog(490523) establishment of cohesion 1 homolog 1 (S. cerevisiae)
naked mole-rat(101718018) establishment of sister chromatid cohesion N-acetyltransferase 1
domestic guinea pig(101787413) establishment of sister chromatid cohesion N-acetyltransferase 1
sheep(101123257) establishment of cohesion 1 homolog 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_056302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_056302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_056302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052911 Rosetta Predictions human pricing
NM_001126299 Rosetta Predictions rat pricing
NM_001081222 Rosetta Predictions mouse pricing
XM_484702 Rosetta Predictions mouse pricing
XM_896758 Rosetta Predictions mouse pricing
XM_896770 Rosetta Predictions mouse pricing
XM_896779 Rosetta Predictions mouse pricing
XM_896786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164975 predicted 2601
2 SASI_Hs02_00361667 predicted 2558
3 SASI_Hs01_00164976 predicted 1402
4 SASI_Hs01_00164977 predicted 1359
5 SASI_Hs01_00164978 predicted 2985
6 SASI_Hs02_00361668 predicted 1826
7 SASI_Hs01_00164979 predicted 1904
8 SASI_Hs01_00164981 predicted 2468
9 SASI_Hs01_00164982 predicted 3396
10 SASI_Hs02_00361669 predicted 1710
11 SASI_Hs01_00164974 predicted 2004
12 SASI_Hs01_00164980 predicted 1093
13 SASI_Hs01_00164983 predicted 3347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253363 predicted 489
2 SASI_Rn02_00253364 predicted 1174
3 SASI_Rn02_00253365 predicted 1093
4 SASI_Rn02_00253366 predicted 857
5 SASI_Rn02_00253367 predicted 1141
6 SASI_Rn02_00253368 predicted 886
7 SASI_Rn02_00253369 predicted 361
8 SASI_Rn02_00253370 predicted 989
9 SASI_Rn02_00253371 predicted 1225
10 SASI_Rn02_00253372 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296381 predicted 2729
2 SASI_Mm02_00296382 predicted 1389
3 SASI_Mm02_00296383 predicted 3090
4 SASI_Mm02_00296384 predicted 1561
5 SASI_Mm02_00296385 predicted 2342
6 SASI_Mm02_00296386 predicted 2259
7 SASI_Mm02_00296387 predicted 2284
8 SASI_Mm02_00296388 predicted 1270
9 SASI_Mm02_00296389 predicted 2884
10 SASI_Mm02_00296390 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203776 predicted 2737
2 SASI_Mm01_00203777 predicted 2579
3 SASI_Mm01_00203778 predicted 2703
4 SASI_Mm01_00203779 predicted 2644
5 SASI_Mm01_00203780 predicted 2736
6 SASI_Mm01_00203781 predicted 2703
7 SASI_Mm01_00203782 predicted 2661
8 SASI_Mm01_00203783 predicted 3189
9 SASI_Mm01_00203784 predicted 2745
10 SASI_Mm01_00203785 predicted 2477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230332 predicted 1505
2 SASI_Mm01_00230333 predicted 1507
3 SASI_Mm01_00230334 predicted 1512
4 SASI_Mm01_00230335 predicted 675
5 SASI_Mm01_00230336 predicted 869
6 SASI_Mm01_00230337 predicted 875
7 SASI_Mm01_00230338 predicted 802
8 SASI_Mm01_00230339 predicted 825
9 SASI_Mm01_00230340 predicted 819
10 SASI_Mm01_00230341 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205242 predicted 1667
2 SASI_Mm01_00205243 predicted 1669
3 SASI_Mm01_00205244 predicted 1685
4 SASI_Mm01_00205245 predicted 840
5 SASI_Mm01_00205246 predicted 1028
6 SASI_Mm01_00205247 predicted 1035
7 SASI_Mm01_00205248 predicted 965
8 SASI_Mm01_00205249 predicted 992
9 SASI_Mm01_00205250 predicted 984
10 SASI_Mm01_00205251 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268474 predicted 1775
2 SASI_Mm01_00268475 predicted 1770
3 SASI_Mm01_00268476 predicted 1785
4 SASI_Mm01_00268477 predicted 934
5 SASI_Mm01_00268478 predicted 1134
6 SASI_Mm01_00268479 predicted 1135
7 SASI_Mm01_00268480 predicted 1062
8 SASI_Mm01_00268481 predicted 1092
9 SASI_Mm01_00268482 predicted 1084
10 SASI_Mm01_00268483 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266752 predicted 1888
2 SASI_Mm01_00266753 predicted 1874
3 SASI_Mm01_00266754 predicted 1891
4 SASI_Mm01_00266755 predicted 1048
5 SASI_Mm01_00266756 predicted 1241
6 SASI_Mm01_00266757 predicted 1248
7 SASI_Mm01_00266758 predicted 1181
8 SASI_Mm01_00266759 predicted 1202
9 SASI_Mm01_00266760 predicted 1205
10 SASI_Mm01_00266761 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_056302
VALIDATED
ESCO1 MISSION shRNA Bacterial Glycerol Stock
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_056302.7-4219s1c1
Sequence:CCGGCCAGCTAAATAGGAAGAATTACTCGAGTAATTCTTCCTATTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-2870s1c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-3610s1c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_056302.7-1497s1c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-1933s1c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_056302
VALIDATED
ESCO1 MISSION shRNA shRNA Plasmid DNA
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_056302.7-4219s1c1
Sequence:CCGGCCAGCTAAATAGGAAGAATTACTCGAGTAATTCTTCCTATTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-2870s1c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-3610s1c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_056302.7-1497s1c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-1933s1c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_056302
VALIDATED
ESCO1 MISSION shRNA Lentiviral Transduction Particles
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_056302.7-4219s1c1
Sequence:CCGGCCAGCTAAATAGGAAGAATTACTCGAGTAATTCTTCCTATTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-2870s1c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-3610s1c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:XM_056302.7-1497s1c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_056302.7-1933s1c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052911
ESCO1 MISSION shRNA Bacterial Glycerol Stock
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000349574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1728s21c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1292s21c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-3405s21c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-2665s21c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052911
ESCO1 MISSION shRNA shRNA Plasmid DNA
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000349574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1728s21c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1292s21c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-3405s21c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-2665s21c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052911
ESCO1 MISSION shRNA Lentiviral Transduction Particles
establishment of sister chromatid cohesion N-acetyltransferase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000349574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1728s21c1
Sequence:CCGGCGGTTCATACACAAGTGAATACTCGAGTATTCACTTGTGTATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-1292s21c1
Sequence:CCGGCGGAGATCACAAAGGCTACAACTCGAGTTGTAGCCTTTGTGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-3405s21c1
Sequence:CCGGGCACTGGTCAATTTCTGGTATCTCGAGATACCAGAAATTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052911.2-2665s21c1
Sequence:CCGGGCCTAAGTGTAATTCCCATTTCTCGAGAAATGGGAATTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081222
VALIDATED
ESCO1 MISSION shRNA Bacterial Glycerol Stock
establishment of sister chromatid cohesion N-acetyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3375s21c1
Sequence:CCGGAGATAGCTTCTCGCATGATTGCTCGAGCAATCATGCGAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3703s21c1
Sequence:CCGGCAATGCAGTAATAGCTTATTACTCGAGTAATAAGCTATTACTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081222.1-1746s21c1
Sequence:CCGGTGCCTGTAACTGCTGATATTACTCGAGTAATATCAGCAGTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2369s21c1
Sequence:CCGGGTAACTTGCCAACGGGATAAACTCGAGTTTATCCCGTTGGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2146s21c1
Sequence:CCGGGCCTGTGAAATGCGTACTAAACTCGAGTTTAGTACGCATTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081222
VALIDATED
ESCO1 MISSION shRNA shRNA Plasmid DNA
establishment of sister chromatid cohesion N-acetyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3375s21c1
Sequence:CCGGAGATAGCTTCTCGCATGATTGCTCGAGCAATCATGCGAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3703s21c1
Sequence:CCGGCAATGCAGTAATAGCTTATTACTCGAGTAATAAGCTATTACTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081222.1-1746s21c1
Sequence:CCGGTGCCTGTAACTGCTGATATTACTCGAGTAATATCAGCAGTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2369s21c1
Sequence:CCGGGTAACTTGCCAACGGGATAAACTCGAGTTTATCCCGTTGGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2146s21c1
Sequence:CCGGGCCTGTGAAATGCGTACTAAACTCGAGTTTAGTACGCATTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081222
VALIDATED
ESCO1 MISSION shRNA Lentiviral Transduction Particles
establishment of sister chromatid cohesion N-acetyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3375s21c1
Sequence:CCGGAGATAGCTTCTCGCATGATTGCTCGAGCAATCATGCGAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-3703s21c1
Sequence:CCGGCAATGCAGTAATAGCTTATTACTCGAGTAATAAGCTATTACTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081222.1-1746s21c1
Sequence:CCGGTGCCTGTAACTGCTGATATTACTCGAGTAATATCAGCAGTTACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2369s21c1
Sequence:CCGGGTAACTTGCCAACGGGATAAACTCGAGTTTATCCCGTTGGCAAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081222.1-2146s21c1
Sequence:CCGGGCCTGTGAAATGCGTACTAAACTCGAGTTTAGTACGCATTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks