EMAIL THIS PAGE TO A FRIEND

ESCO2

establishment of sister chromatid cohesion N-acetyltransferase 2

Synonyms: 2410004I17Rik EFO2 RBS
UniProtKB ID: Q56NI9, B3KW59
Gene ID:
Human(157570) Summary: This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
Mouse(71988) establishment of cohesion 1 homolog 2 (S. cerevisiae)
Rat(691979) establishment of sister chromatid cohesion N-acetyltransferase 2
sheep(101114418) establishment of cohesion 1 homolog 2 (S. cerevisiae)
domestic guinea pig(100735054) establishment of sister chromatid cohesion N-acetyltransferase 2
naked mole-rat(101720068) establishment of sister chromatid cohesion N-acetyltransferase 2
Zebrafish(445395) establishment of cohesion 1 homolog 2
cow(538949) establishment of cohesion 1 homolog 2 (S. cerevisiae)
Horse(100060754) establishment of cohesion 1 homolog 2 (S. cerevisiae)
domestic cat(101093351) establishment of cohesion 1 homolog 2 (S. cerevisiae)
dog(486098) establishment of cohesion 1 homolog 2 (S. cerevisiae)
chicken(422004) establishment of cohesion 1 homolog 2 (S. cerevisiae)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017420 Rosetta Predictions human pricing
XM_001080534 Rosetta Predictions rat pricing
NM_028039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181592 predicted 536
2 SASI_Hs02_00306747 predicted 1576
3 SASI_Hs01_00181594 predicted 1346
4 SASI_Hs01_00181595 predicted 387
5 SASI_Hs01_00181596 predicted 1645
6 SASI_Hs01_00181597 predicted 304
7 SASI_Hs01_00181598 predicted 285
8 SASI_Hs01_00181599 predicted 1472
9 SASI_Hs01_00181600 predicted 523
10 SASI_Hs02_00306748 predicted 553
11 SASI_Hs01_00181593 predicted 555
12 SASI_Hs01_00181601 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368313 predicted 1661
2 SASI_Rn02_00368314 predicted 1715
3 SASI_Rn02_00368315 predicted 881
4 SASI_Rn02_00368316 predicted 1678
5 SASI_Rn02_00368317 predicted 796
6 SASI_Rn02_00368318 predicted 691
7 SASI_Rn02_00368319 predicted 234
8 SASI_Rn02_00368320 predicted 1115
9 SASI_Rn02_00368321 predicted 852
10 SASI_Rn02_00368322 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333200 predicted 261
2 SASI_Mm01_00110043 predicted 1845
3 SASI_Mm01_00110045 predicted 1840
4 SASI_Mm02_00333201 predicted 213
5 SASI_Mm01_00110047 predicted 1401
6 SASI_Mm02_00333202 predicted 976
7 SASI_Mm01_00110049 predicted 1295
8 SASI_Mm02_00333203 predicted 1555
9 SASI_Mm01_00110051 predicted 1376
10 SASI_Mm02_00333204 predicted 284
11 SASI_Mm01_00110042 predicted 963
12 SASI_Mm01_00110044 predicted 979
13 SASI_Mm01_00110046 predicted 867
14 SASI_Mm01_00110048 predicted 897
15 SASI_Mm01_00110050 predicted 1560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028039
VALIDATED
ESCO2 MISSION shRNA Bacterial Glycerol Stock
establishment of sister chromatid cohesion N-acetyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028039.2-2099s21c1
Sequence:CCGGAGGATTGTTTGGGATTCAAAGCTCGAGCTTTGAATCCCAAACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1367s21c1
Sequence:CCGGTCCAACCCTGAAGACGAAATACTCGAGTATTTCGTCTTCAGGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-707s21c1
Sequence:CCGGCCAAATCAAGTGACCTATAAGCTCGAGCTTATAGGTCACTTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1493s21c1
Sequence:CCGGCTGCCACGTGATCCAAGTTATCTCGAGATAACTTGGATCACGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-2220s1c1
Sequence:CCGGGCAACCACTTTACAAGCATATCTCGAGATATGCTTGTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-557s1c1
Sequence:CCGGCTGCCAAATATCAACCAAATTCTCGAGAATTTGGTTGATATTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1636s1c1
Sequence:CCGGCGGTGTTCAGATGTACCAGAACTCGAGTTCTGGTACATCTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-214s1c1
Sequence:CCGGCCATCACCTAATAAGAAACATCTCGAGATGTTTCTTATTAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1129s1c1
Sequence:CCGGGCATGTACTAACTTCTTGAAACTCGAGTTTCAAGAAGTTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028039
VALIDATED
ESCO2 MISSION shRNA shRNA Plasmid DNA
establishment of sister chromatid cohesion N-acetyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028039.2-2099s21c1
Sequence:CCGGAGGATTGTTTGGGATTCAAAGCTCGAGCTTTGAATCCCAAACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1367s21c1
Sequence:CCGGTCCAACCCTGAAGACGAAATACTCGAGTATTTCGTCTTCAGGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-707s21c1
Sequence:CCGGCCAAATCAAGTGACCTATAAGCTCGAGCTTATAGGTCACTTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1493s21c1
Sequence:CCGGCTGCCACGTGATCCAAGTTATCTCGAGATAACTTGGATCACGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-2220s1c1
Sequence:CCGGGCAACCACTTTACAAGCATATCTCGAGATATGCTTGTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-557s1c1
Sequence:CCGGCTGCCAAATATCAACCAAATTCTCGAGAATTTGGTTGATATTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1636s1c1
Sequence:CCGGCGGTGTTCAGATGTACCAGAACTCGAGTTCTGGTACATCTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-214s1c1
Sequence:CCGGCCATCACCTAATAAGAAACATCTCGAGATGTTTCTTATTAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1129s1c1
Sequence:CCGGGCATGTACTAACTTCTTGAAACTCGAGTTTCAAGAAGTTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028039
VALIDATED
ESCO2 MISSION shRNA Lentiviral Transduction Particles
establishment of sister chromatid cohesion N-acetyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028039.2-2099s21c1
Sequence:CCGGAGGATTGTTTGGGATTCAAAGCTCGAGCTTTGAATCCCAAACAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1367s21c1
Sequence:CCGGTCCAACCCTGAAGACGAAATACTCGAGTATTTCGTCTTCAGGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-707s21c1
Sequence:CCGGCCAAATCAAGTGACCTATAAGCTCGAGCTTATAGGTCACTTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028039.2-1493s21c1
Sequence:CCGGCTGCCACGTGATCCAAGTTATCTCGAGATAACTTGGATCACGTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-2220s1c1
Sequence:CCGGGCAACCACTTTACAAGCATATCTCGAGATATGCTTGTAAAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-557s1c1
Sequence:CCGGCTGCCAAATATCAACCAAATTCTCGAGAATTTGGTTGATATTTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1636s1c1
Sequence:CCGGCGGTGTTCAGATGTACCAGAACTCGAGTTCTGGTACATCTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-214s1c1
Sequence:CCGGCCATCACCTAATAAGAAACATCTCGAGATGTTTCTTATTAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028039.1-1129s1c1
Sequence:CCGGGCATGTACTAACTTCTTGAAACTCGAGTTTCAAGAAGTTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017420
ESCO2 MISSION shRNA Bacterial Glycerol Stock
establishment of sister chromatid cohesion N-acetyltransferase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2149s21c1
Sequence:CCGGATGAAACTTTGTAGCTATAACCTCGAGGTTATAGCTACAAAGTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2285s21c1
Sequence:CCGGCAGAAGCAAACAGGCAAATTTCTCGAGAAATTTGCCTGTTTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017420.2-157s21c1
Sequence:CCGGATCTGTTTCCATCACCTAATACTCGAGTATTAGGTGATGGAAACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2253s21c1
Sequence:CCGGCACTCTTAGACCAGGATTATCCTCGAGGATAATCCTGGTCTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1812s1c1
Sequence:CCGGCCAACACCAGATGGCAAGTTACTCGAGTAACTTGCCATCTGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1548s1c1
Sequence:CCGGGTTGGGTGTTTAATTGCAGAACTCGAGTTCTGCAATTAAACACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1284s1c1
Sequence:CCGGCCTGAAGATGAAATGCAGCATCTCGAGATGCTGCATTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1249s1c1
Sequence:CCGGGCAAGTCTTGTGGTATGATATCTCGAGATATCATACCACAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1316s1c1
Sequence:CCGGCCACAGGTTTCTGGAAGGAATCTCGAGATTCCTTCCAGAAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2316s1c1
Sequence:CCGGGCAAGTAATTTCTGTGCCCAACTCGAGTTGGGCACAGAAATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2853s1c1
Sequence:CCGGGCACCTTACTTGTTCTGAGATCTCGAGATCTCAGAACAAGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017420
ESCO2 MISSION shRNA shRNA Plasmid DNA
establishment of sister chromatid cohesion N-acetyltransferase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2149s21c1
Sequence:CCGGATGAAACTTTGTAGCTATAACCTCGAGGTTATAGCTACAAAGTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2285s21c1
Sequence:CCGGCAGAAGCAAACAGGCAAATTTCTCGAGAAATTTGCCTGTTTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017420.2-157s21c1
Sequence:CCGGATCTGTTTCCATCACCTAATACTCGAGTATTAGGTGATGGAAACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2253s21c1
Sequence:CCGGCACTCTTAGACCAGGATTATCCTCGAGGATAATCCTGGTCTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1812s1c1
Sequence:CCGGCCAACACCAGATGGCAAGTTACTCGAGTAACTTGCCATCTGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1548s1c1
Sequence:CCGGGTTGGGTGTTTAATTGCAGAACTCGAGTTCTGCAATTAAACACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1284s1c1
Sequence:CCGGCCTGAAGATGAAATGCAGCATCTCGAGATGCTGCATTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1249s1c1
Sequence:CCGGGCAAGTCTTGTGGTATGATATCTCGAGATATCATACCACAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1316s1c1
Sequence:CCGGCCACAGGTTTCTGGAAGGAATCTCGAGATTCCTTCCAGAAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2316s1c1
Sequence:CCGGGCAAGTAATTTCTGTGCCCAACTCGAGTTGGGCACAGAAATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2853s1c1
Sequence:CCGGGCACCTTACTTGTTCTGAGATCTCGAGATCTCAGAACAAGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017420
ESCO2 MISSION shRNA Lentiviral Transduction Particles
establishment of sister chromatid cohesion N-acetyltransferase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2149s21c1
Sequence:CCGGATGAAACTTTGTAGCTATAACCTCGAGGTTATAGCTACAAAGTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2285s21c1
Sequence:CCGGCAGAAGCAAACAGGCAAATTTCTCGAGAAATTTGCCTGTTTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017420.2-157s21c1
Sequence:CCGGATCTGTTTCCATCACCTAATACTCGAGTATTAGGTGATGGAAACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017420.2-2253s21c1
Sequence:CCGGCACTCTTAGACCAGGATTATCCTCGAGGATAATCCTGGTCTAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1812s1c1
Sequence:CCGGCCAACACCAGATGGCAAGTTACTCGAGTAACTTGCCATCTGGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1548s1c1
Sequence:CCGGGTTGGGTGTTTAATTGCAGAACTCGAGTTCTGCAATTAAACACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017420.1-1284s1c1
Sequence:CCGGCCTGAAGATGAAATGCAGCATCTCGAGATGCTGCATTTCATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1249s1c1
Sequence:CCGGGCAAGTCTTGTGGTATGATATCTCGAGATATCATACCACAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017420.1-1316s1c1
Sequence:CCGGCCACAGGTTTCTGGAAGGAATCTCGAGATTCCTTCCAGAAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2316s1c1
Sequence:CCGGGCAAGTAATTTCTGTGCCCAACTCGAGTTGGGCACAGAAATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017420.1-2853s1c1
Sequence:CCGGGCACCTTACTTGTTCTGAGATCTCGAGATCTCAGAACAAGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks