EMAIL THIS PAGE TO A FRIEND

ESD

esterase D

58 Gene Product Result for
Synonyms: FGH
UniProtKB ID: P10768, Q5TBU8, Q5TBV0, Q5TBV2, Q9BVJ2
Gene ID:
Human(2098) Summary: This gene encodes a serine hydrolase that belongs to the esterase D family. The encoded enzyme is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. This gene is used as a genetic marker for retinoblastoma and Wilson's disease. [provided by RefSeq, Feb 2009]
Mouse(13885) esterase D/formylglutathione hydrolase
Rat(290401) esterase D
sheep(101113080) esterase D
Zebrafish(550494) esterase D/formylglutathione hydrolase
dog(607116) esterase D
cow(535653) esterase D
chicken(418856) esterase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001984 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001984 Rosetta Predictions human pricing
NM_001106051 Rosetta Predictions rat pricing
NM_016903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206972 predicted 874
2 SASI_Hs01_00206976 predicted 639
3 SASI_Hs01_00206978 predicted 441
4 SASI_Hs01_00206979 predicted 687
5 SASI_Hs01_00206980 predicted 780
6 SASI_Hs02_00332966 predicted 740
7 SASI_Hs02_00332967 predicted 699
8 SASI_Hs02_00332968 predicted 279
9 SASI_Hs02_00332969 predicted 530
10 SASI_Hs02_00332970 predicted 336
11 SASI_Hs01_00206971 predicted 278
12 SASI_Hs01_00206973 predicted 508
13 SASI_Hs01_00206974 predicted 329
14 SASI_Hs01_00206975 predicted 309
15 SASI_Hs01_00206977 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215142 predicted 738
2 SASI_Rn02_00215143 predicted 400
3 SASI_Rn02_00215144 predicted 370
4 SASI_Rn02_00215145 predicted 687
5 SASI_Rn02_00215146 predicted 256
6 SASI_Rn02_00215147 predicted 652
7 SASI_Rn02_00215148 predicted 242
8 SASI_Rn02_00215149 predicted 813
9 SASI_Rn02_00215150 predicted 429
10 SASI_Rn02_00215151 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049473 predicted 793
2 SASI_Mm01_00049472 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016903
VALIDATED
ESD MISSION shRNA Bacterial Glycerol Stock
esterase D
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1139s1c1
Sequence:CCGGGCTCTCTTGGTGGTGTATGTTCTCGAGAACATACACCACCAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-308s1c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-117s1c1
Sequence:CCGGGCAGTGTTGAGCTGAAATGTACTCGAGTACATTTCAGCTCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-797s1c1
Sequence:CCGGCCTGTTGTGTTTAGACTACAACTCGAGTTGTAGTCTAAACACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-515s1c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016903.2-437s1c1
Sequence:CCGGCCACAACTCATAAATGCCAATCTCGAGATTGGCATTTATGAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1046s1c1
Sequence:CCGGCCACCATTCACGTAGGAGTTTCTCGAGAAACTCCTACGTGAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-307s21c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016903.4-1046s21c1
Sequence:CCGGCACCATTCACGTAGGAGTTTACTCGAGTAAACTCCTACGTGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-514s21c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-839s21c1
Sequence:CCGGACTTCATTGCAACTTTCATCGCTCGAGCGATGAAAGTTGCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-827s21c1
Sequence:CCGGATCATAGCTACTACTTCATTGCTCGAGCAATGAAGTAGTAGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016903
VALIDATED
ESD MISSION shRNA shRNA Plasmid DNA
esterase D
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1139s1c1
Sequence:CCGGGCTCTCTTGGTGGTGTATGTTCTCGAGAACATACACCACCAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-308s1c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-117s1c1
Sequence:CCGGGCAGTGTTGAGCTGAAATGTACTCGAGTACATTTCAGCTCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-797s1c1
Sequence:CCGGCCTGTTGTGTTTAGACTACAACTCGAGTTGTAGTCTAAACACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-515s1c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016903.2-437s1c1
Sequence:CCGGCCACAACTCATAAATGCCAATCTCGAGATTGGCATTTATGAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1046s1c1
Sequence:CCGGCCACCATTCACGTAGGAGTTTCTCGAGAAACTCCTACGTGAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-307s21c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016903.4-1046s21c1
Sequence:CCGGCACCATTCACGTAGGAGTTTACTCGAGTAAACTCCTACGTGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-514s21c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-839s21c1
Sequence:CCGGACTTCATTGCAACTTTCATCGCTCGAGCGATGAAAGTTGCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-827s21c1
Sequence:CCGGATCATAGCTACTACTTCATTGCTCGAGCAATGAAGTAGTAGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016903
VALIDATED
ESD MISSION shRNA Lentiviral Transduction Particles
esterase D
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1139s1c1
Sequence:CCGGGCTCTCTTGGTGGTGTATGTTCTCGAGAACATACACCACCAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-308s1c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-117s1c1
Sequence:CCGGGCAGTGTTGAGCTGAAATGTACTCGAGTACATTTCAGCTCAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-797s1c1
Sequence:CCGGCCTGTTGTGTTTAGACTACAACTCGAGTTGTAGTCTAAACACAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016903.2-515s1c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016903.2-437s1c1
Sequence:CCGGCCACAACTCATAAATGCCAATCTCGAGATTGGCATTTATGAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016903.2-1046s1c1
Sequence:CCGGCCACCATTCACGTAGGAGTTTCTCGAGAAACTCCTACGTGAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-307s21c1
Sequence:CCGGCGTGGCTGCAATATCAAAGGACTCGAGTCCTTTGATATTGCAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016903.4-1046s21c1
Sequence:CCGGCACCATTCACGTAGGAGTTTACTCGAGTAAACTCCTACGTGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-514s21c1
Sequence:CCGGGCTCTGATTTGTGCTTTGAAACTCGAGTTTCAAAGCACAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-839s21c1
Sequence:CCGGACTTCATTGCAACTTTCATCGCTCGAGCGATGAAAGTTGCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016903.4-827s21c1
Sequence:CCGGATCATAGCTACTACTTCATTGCTCGAGCAATGAAGTAGTAGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001984
VALIDATED
ESD MISSION shRNA Bacterial Glycerol Stock
esterase D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-569s1c1
Sequence:CCGGCCCAACTCATAAATGCCAATTCTCGAGAATTGGCATTTATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-700s1c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-377s1c1
Sequence:CCGGCTGGTTATCATCAGTCTGCTTCTCGAGAAGCAGACTGATGATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-940s1c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-508s1c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-508s21c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-940s21c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-435s21c1
Sequence:CCGGCCCTCGTGGCTGCAATATTAACTCGAGTTAATATTGCAGCCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-1038s21c1
Sequence:CCGGCTCCAAATAAGAGAATCTCTTCTCGAGAAGAGATTCTCTTATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-700s21c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001984
VALIDATED
ESD MISSION shRNA shRNA Plasmid DNA
esterase D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-569s1c1
Sequence:CCGGCCCAACTCATAAATGCCAATTCTCGAGAATTGGCATTTATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-700s1c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-377s1c1
Sequence:CCGGCTGGTTATCATCAGTCTGCTTCTCGAGAAGCAGACTGATGATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-940s1c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-508s1c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-508s21c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-940s21c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-435s21c1
Sequence:CCGGCCCTCGTGGCTGCAATATTAACTCGAGTTAATATTGCAGCCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-1038s21c1
Sequence:CCGGCTCCAAATAAGAGAATCTCTTCTCGAGAAGAGATTCTCTTATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-700s21c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001984
VALIDATED
ESD MISSION shRNA Lentiviral Transduction Particles
esterase D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-569s1c1
Sequence:CCGGCCCAACTCATAAATGCCAATTCTCGAGAATTGGCATTTATGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-700s1c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-377s1c1
Sequence:CCGGCTGGTTATCATCAGTCTGCTTCTCGAGAAGCAGACTGATGATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-940s1c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001984.1-508s1c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-508s21c1
Sequence:CCGGGCCACTGAAGATCCTTGGAAACTCGAGTTTCCAAGGATCTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-940s21c1
Sequence:CCGGCGATTGCAAGAGGGTTATGATCTCGAGATCATAACCCTCTTGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-435s21c1
Sequence:CCGGCCCTCGTGGCTGCAATATTAACTCGAGTTAATATTGCAGCCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-1038s21c1
Sequence:CCGGCTCCAAATAAGAGAATCTCTTCTCGAGAAGAGATTCTCTTATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001984.1-700s21c1
Sequence:CCGGGCTCCAATTTGCAACCCTGTACTCGAGTACAGGGTTGCAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks