EMAIL THIS PAGE TO A FRIEND

ESF1

ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)

71 Gene Product Result for
Synonyms: ABTAP C20orf6 bA526K24.1
UniProtKB ID: Q9H501, Q86X92, Q9H9Q5, Q9HA35, Q9NX93, Q9P1S6
Gene ID:
Mouse(66580) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Rat(366203) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Zebrafish(326718) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
chicken(428551) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
dog(477151) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
domestic cat(101095972) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
cow(533375) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Horse(100063203) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
sheep(101110781) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Domestic Rabbit(100348890) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
naked mole-rat(101704156) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
domestic guinea pig(100715445) ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016649 Rosetta Predictions human pricing
XM_001081317 Rosetta Predictions rat pricing
XM_345440 Rosetta Predictions rat pricing
NM_001081090 Rosetta Predictions mouse pricing
XM_130548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103388 predicted 1306
2 SASI_Hs01_00103390 predicted 1553
3 SASI_Hs01_00103392 predicted 2654
4 SASI_Hs01_00103393 predicted 1417
5 SASI_Hs01_00103394 predicted 1455
6 SASI_Hs01_00103396 predicted 2586
7 SASI_Hs02_00349824 predicted 2510
8 SASI_Hs02_00349825 predicted 1247
9 SASI_Hs02_00349826 predicted 1481
10 SASI_Hs02_00349827 predicted 2655
11 SASI_Hs01_00103387 predicted 2257
12 SASI_Hs01_00103389 predicted 1595
13 SASI_Hs01_00103391 predicted 1201
14 SASI_Hs01_00103395 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371401 predicted 1553
2 SASI_Rn02_00371402 predicted 1490
3 SASI_Rn02_00371403 predicted 1571
4 SASI_Rn02_00371404 predicted 1604
5 SASI_Rn02_00371405 predicted 1547
6 SASI_Rn02_00371406 predicted 1409
7 SASI_Rn02_00371407 predicted 1400
8 SASI_Rn02_00371408 predicted 1461
9 SASI_Rn02_00371409 predicted 2452
10 SASI_Rn02_00371410 predicted 2493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398377 predicted 1558
2 SASI_Rn02_00398378 predicted 1486
3 SASI_Rn02_00398379 predicted 1571
4 SASI_Rn02_00398380 predicted 1607
5 SASI_Rn02_00398381 predicted 1544
6 SASI_Rn02_00398382 predicted 1416
7 SASI_Rn02_00398383 predicted 1399
8 SASI_Rn02_00398384 predicted 1463
9 SASI_Rn02_00398385 predicted 2451
10 SASI_Rn02_00398386 predicted 2488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295081 predicted 1644
2 SASI_Mm02_00295082 predicted 1507
3 SASI_Mm02_00295083 predicted 1588
4 SASI_Mm02_00295084 predicted 1388
5 SASI_Mm02_00295085 predicted 1427
6 SASI_Mm02_00295086 predicted 1572
7 SASI_Mm02_00295087 predicted 1183
8 SASI_Mm02_00295088 predicted 2680
9 SASI_Mm02_00295089 predicted 2492
10 SASI_Mm02_00295090 predicted 1625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281490 predicted 2483
2 SASI_Mm01_00281491 predicted 3084
3 SASI_Mm01_00281492 predicted 3156
4 SASI_Mm01_00281493 predicted 2677
5 SASI_Mm01_00281494 predicted 2925
6 SASI_Mm01_00281495 predicted 3003
7 SASI_Mm01_00281496 predicted 2510
8 SASI_Mm01_00281497 predicted 3157
9 SASI_Mm01_00281498 predicted 2918
10 SASI_Mm01_00281499 predicted 3056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016649
VALIDATED
ESF1 MISSION shRNA Bacterial Glycerol Stock
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016649.3-2992s21c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-1391s1c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-741s1c1
Sequence:CCGGATCAGTGGTTCAACTCATAATCTCGAGATTATGAGTTGAACCACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-832s21c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-1391s21c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-2584s21c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2938s1c1
Sequence:CCGGGTGGAAAGTTACTCTAGCTTTCTCGAGAAAGCTAGAGTAACTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-832s1c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2512s1c1
Sequence:CCGGCAAGAACTTACTCAGGCAATACTCGAGTATTGCCTGAGTAAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016649.3-2992s1c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2503s1c1
Sequence:CCGGCGGAAAGAACAAGAACTTACTCTCGAGAGTAAGTTCTTGTTCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2584s1c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2092s1c1
Sequence:CCGGCCCTCTGATGTTGATTTGAATCTCGAGATTCAAATCAACATCAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-680s1c1
Sequence:CCGGGCACCTCTGAAATTGTGAAATCTCGAGATTTCACAATTTCAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016649
VALIDATED
ESF1 MISSION shRNA shRNA Plasmid DNA
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016649.3-2992s21c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-1391s1c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-741s1c1
Sequence:CCGGATCAGTGGTTCAACTCATAATCTCGAGATTATGAGTTGAACCACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-832s21c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-1391s21c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-2584s21c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2938s1c1
Sequence:CCGGGTGGAAAGTTACTCTAGCTTTCTCGAGAAAGCTAGAGTAACTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-832s1c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2512s1c1
Sequence:CCGGCAAGAACTTACTCAGGCAATACTCGAGTATTGCCTGAGTAAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016649.3-2992s1c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2503s1c1
Sequence:CCGGCGGAAAGAACAAGAACTTACTCTCGAGAGTAAGTTCTTGTTCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2584s1c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2092s1c1
Sequence:CCGGCCCTCTGATGTTGATTTGAATCTCGAGATTCAAATCAACATCAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-680s1c1
Sequence:CCGGGCACCTCTGAAATTGTGAAATCTCGAGATTTCACAATTTCAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016649
VALIDATED
ESF1 MISSION shRNA Lentiviral Transduction Particles
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016649.3-2992s21c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-1391s1c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-741s1c1
Sequence:CCGGATCAGTGGTTCAACTCATAATCTCGAGATTATGAGTTGAACCACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-832s21c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-1391s21c1
Sequence:CCGGTCAAACGACTGAAGTACTATTCTCGAGAATAGTACTTCAGTCGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016649.3-2584s21c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2938s1c1
Sequence:CCGGGTGGAAAGTTACTCTAGCTTTCTCGAGAAAGCTAGAGTAACTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-832s1c1
Sequence:CCGGGATTCAGAAAGCGTTAGTGAACTCGAGTTCACTAACGCTTTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2512s1c1
Sequence:CCGGCAAGAACTTACTCAGGCAATACTCGAGTATTGCCTGAGTAAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016649.3-2992s1c1
Sequence:CCGGGAGCAGTATCTACTCAAGTTTCTCGAGAAACTTGAGTAGATACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016649.3-2503s1c1
Sequence:CCGGCGGAAAGAACAAGAACTTACTCTCGAGAGTAAGTTCTTGTTCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2584s1c1
Sequence:CCGGCCTGCTTTGTCAATGTTGATTCTCGAGAATCAACATTGACAAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-2092s1c1
Sequence:CCGGCCCTCTGATGTTGATTTGAATCTCGAGATTCAAATCAACATCAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016649.3-680s1c1
Sequence:CCGGGCACCTCTGAAATTGTGAAATCTCGAGATTTCACAATTTCAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081090
VALIDATED
ESF1 MISSION shRNA Bacterial Glycerol Stock
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1309s21c1
Sequence:CCGGCCAGTAGAGTTACTAAGTATTCTCGAGAATACTTAGTAACTCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-3158s21c1
Sequence:CCGGAGATGCTATTTACAATCTATGCTCGAGCATAGATTGTAAATAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081090.1-2584s21c1
Sequence:CCGGGCCTTGTCCATGCTGATTAAACTCGAGTTTAATCAGCATGGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1563s21c1
Sequence:CCGGAGTTGATTTAACGGCATATAACTCGAGTTATATGCCGTTAAATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1853s21c1
Sequence:CCGGGACAGCTCTTGCAGGTTATTCCTCGAGGAATAACCTGCAAGAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081090
VALIDATED
ESF1 MISSION shRNA shRNA Plasmid DNA
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1309s21c1
Sequence:CCGGCCAGTAGAGTTACTAAGTATTCTCGAGAATACTTAGTAACTCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-3158s21c1
Sequence:CCGGAGATGCTATTTACAATCTATGCTCGAGCATAGATTGTAAATAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081090.1-2584s21c1
Sequence:CCGGGCCTTGTCCATGCTGATTAAACTCGAGTTTAATCAGCATGGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1563s21c1
Sequence:CCGGAGTTGATTTAACGGCATATAACTCGAGTTATATGCCGTTAAATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1853s21c1
Sequence:CCGGGACAGCTCTTGCAGGTTATTCCTCGAGGAATAACCTGCAAGAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081090
VALIDATED
ESF1 MISSION shRNA Lentiviral Transduction Particles
ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1309s21c1
Sequence:CCGGCCAGTAGAGTTACTAAGTATTCTCGAGAATACTTAGTAACTCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-3158s21c1
Sequence:CCGGAGATGCTATTTACAATCTATGCTCGAGCATAGATTGTAAATAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081090.1-2584s21c1
Sequence:CCGGGCCTTGTCCATGCTGATTAAACTCGAGTTTAATCAGCATGGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1563s21c1
Sequence:CCGGAGTTGATTTAACGGCATATAACTCGAGTTATATGCCGTTAAATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081090.1-1853s21c1
Sequence:CCGGGACAGCTCTTGCAGGTTATTCCTCGAGGAATAACCTGCAAGAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)