EMAIL THIS PAGE TO A FRIEND

ESM1

endothelial cell-specific molecule 1

106 Gene Product Result for
Synonyms: endocan
UniProtKB ID: Q9NQ30, B2R4G3, Q15330, Q3V4E3, Q96ES3
Gene ID:
Human(11082) Summary: This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(71690) endothelial cell-specific molecule 1
Rat(64536) endothelial cell-specific molecule 1
Zebrafish(767774) endothelial cell-specific molecule 1
cow(539571) endothelial cell-specific molecule 1
domestic cat(101088303) endothelial cell-specific molecule 1
dog(489201) endothelial cell-specific molecule 1
chicken(430807) endothelial cell-specific molecule 1
Thale Cress(820639) epithiospecifier modifier 1
sheep(101117876) endothelial cell-specific molecule 1
domestic guinea pig(100721245) endothelial cell-specific molecule 1
naked mole-rat(101696860) endothelial cell-specific molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007036 Rosetta Predictions human pricing
NM_022604 Rosetta Predictions rat pricing
NM_023612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044141 predicted 454
2 SASI_Hs01_00044142 predicted 537
3 SASI_Hs01_00044143 predicted 864
4 SASI_Hs01_00044144 predicted 481
5 SASI_Hs01_00044145 predicted 523
6 SASI_Hs01_00044146 predicted 783
7 SASI_Hs01_00044147 predicted 813
8 SASI_Hs01_00044148 predicted 779
9 SASI_Hs01_00044149 predicted 765
10 SASI_Hs02_00342816 predicted 771
11 SASI_Hs01_00044140 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108894 predicted 203
2 SASI_Rn01_00108895 predicted 223
3 SASI_Rn01_00108896 predicted 413
4 SASI_Rn01_00108897 predicted 716
5 SASI_Rn01_00108898 predicted 843
6 SASI_Rn01_00108899 predicted 854
7 SASI_Rn01_00108900 predicted 972
8 SASI_Rn01_00108901 predicted 840
9 SASI_Rn01_00108902 predicted 715
10 SASI_Rn01_00108903 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195907 predicted 367
2 SASI_Mm01_00195908 predicted 728
3 SASI_Mm01_00195909 predicted 251
4 SASI_Mm01_00195910 predicted 1204
5 SASI_Mm01_00195911 predicted 290
6 SASI_Mm02_00327212 predicted 725
7 SASI_Mm01_00195912 predicted 522
8 SASI_Mm01_00195913 predicted 251
9 SASI_Mm01_00195914 predicted 240
10 SASI_Mm01_00195915 predicted 459
11 SASI_Mm01_00195916 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023612
ESM1 MISSION shRNA Bacterial Glycerol Stock
endothelial cell-specific molecule 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023612.3-517s1c1
Sequence:CCGGCAAAGAGACTTGCAATTGCCACTCGAGTGGCAATTGCAAGTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-466s1c1
Sequence:CCGGCGAGTTTGGTATCTGCAAAGACTCGAGTCTTTGCAGATACCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-502s1c1
Sequence:CCGGCTTCGGGATGGAATGCAAAGACTCGAGTCTTTGCATTCCATCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1023s1c1
Sequence:CCGGGCTGTCGATGAGTAATCCAATCTCGAGATTGGATTACTCATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1241s1c1
Sequence:CCGGGCCTTGAAGGAAGTGAGATATCTCGAGATATCTCACTTCCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023612
ESM1 MISSION shRNA shRNA Plasmid DNA
endothelial cell-specific molecule 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023612.3-517s1c1
Sequence:CCGGCAAAGAGACTTGCAATTGCCACTCGAGTGGCAATTGCAAGTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-466s1c1
Sequence:CCGGCGAGTTTGGTATCTGCAAAGACTCGAGTCTTTGCAGATACCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-502s1c1
Sequence:CCGGCTTCGGGATGGAATGCAAAGACTCGAGTCTTTGCATTCCATCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1023s1c1
Sequence:CCGGGCTGTCGATGAGTAATCCAATCTCGAGATTGGATTACTCATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1241s1c1
Sequence:CCGGGCCTTGAAGGAAGTGAGATATCTCGAGATATCTCACTTCCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023612
ESM1 MISSION shRNA Lentiviral Transduction Particles
endothelial cell-specific molecule 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023612.3-517s1c1
Sequence:CCGGCAAAGAGACTTGCAATTGCCACTCGAGTGGCAATTGCAAGTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-466s1c1
Sequence:CCGGCGAGTTTGGTATCTGCAAAGACTCGAGTCTTTGCAGATACCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023612.3-502s1c1
Sequence:CCGGCTTCGGGATGGAATGCAAAGACTCGAGTCTTTGCATTCCATCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1023s1c1
Sequence:CCGGGCTGTCGATGAGTAATCCAATCTCGAGATTGGATTACTCATCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023612.3-1241s1c1
Sequence:CCGGGCCTTGAAGGAAGTGAGATATCTCGAGATATCTCACTTCCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007036
ESM1 MISSION shRNA Bacterial Glycerol Stock
endothelial cell-specific molecule 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-591s1c1
Sequence:CCGGCCCGTAATGAGGAAATGGTTACTCGAGTAACCATTTCCTCATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-309s1c1
Sequence:CCGGCTGAGGTGTCAGCCTTCTAATCTCGAGATTAGAAGGCTGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-558s1c1
Sequence:CCGGGAAGAAGTTGTGAAAGAGAATCTCGAGATTCTCTTTCACAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-130s1c1
Sequence:CCGGGCAATAATTATGCGGTGGACTCTCGAGAGTCCACCGCATAATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-470s1c1
Sequence:CCGGCTTCCAATATTCAGTAACCAACTCGAGTTGGTTACTGAATATTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-772s21c1
Sequence:CCGGTAGGATACTTACAATCCATAACTCGAGTTATGGATTGTAAGTATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007036.4-530s21c1
Sequence:CCGGTGGCATCTGGAGATGGCAATACTCGAGTATTGCCATCTCCAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-951s21c1
Sequence:CCGGAGACCGCAGTGAGTCAAATTACTCGAGTAATTTGACTCACTGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007036
ESM1 MISSION shRNA shRNA Plasmid DNA
endothelial cell-specific molecule 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-591s1c1
Sequence:CCGGCCCGTAATGAGGAAATGGTTACTCGAGTAACCATTTCCTCATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-309s1c1
Sequence:CCGGCTGAGGTGTCAGCCTTCTAATCTCGAGATTAGAAGGCTGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-558s1c1
Sequence:CCGGGAAGAAGTTGTGAAAGAGAATCTCGAGATTCTCTTTCACAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-130s1c1
Sequence:CCGGGCAATAATTATGCGGTGGACTCTCGAGAGTCCACCGCATAATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-470s1c1
Sequence:CCGGCTTCCAATATTCAGTAACCAACTCGAGTTGGTTACTGAATATTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-772s21c1
Sequence:CCGGTAGGATACTTACAATCCATAACTCGAGTTATGGATTGTAAGTATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007036.4-530s21c1
Sequence:CCGGTGGCATCTGGAGATGGCAATACTCGAGTATTGCCATCTCCAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-951s21c1
Sequence:CCGGAGACCGCAGTGAGTCAAATTACTCGAGTAATTTGACTCACTGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007036
ESM1 MISSION shRNA Lentiviral Transduction Particles
endothelial cell-specific molecule 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-591s1c1
Sequence:CCGGCCCGTAATGAGGAAATGGTTACTCGAGTAACCATTTCCTCATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-309s1c1
Sequence:CCGGCTGAGGTGTCAGCCTTCTAATCTCGAGATTAGAAGGCTGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-558s1c1
Sequence:CCGGGAAGAAGTTGTGAAAGAGAATCTCGAGATTCTCTTTCACAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-130s1c1
Sequence:CCGGGCAATAATTATGCGGTGGACTCTCGAGAGTCCACCGCATAATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007036.2-470s1c1
Sequence:CCGGCTTCCAATATTCAGTAACCAACTCGAGTTGGTTACTGAATATTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-772s21c1
Sequence:CCGGTAGGATACTTACAATCCATAACTCGAGTTATGGATTGTAAGTATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007036.4-530s21c1
Sequence:CCGGTGGCATCTGGAGATGGCAATACTCGAGTATTGCCATCTCCAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007036.4-951s21c1
Sequence:CCGGAGACCGCAGTGAGTCAAATTACTCGAGTAATTTGACTCACTGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks