EMAIL THIS PAGE TO A FRIEND

ESPN

espin

156 Gene Product Result for
Synonyms: DFNB36
UniProtKB ID: B1AK53, Q6XYB2, Q9H0A2, Q9Y329
Gene ID:
Human(83715) Summary: This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
Mouse(56226) espin
Rat(56227) espin
dog(489631) espin
cow(539821) espin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031475 Rosetta Predictions human pricing
NM_019622 Rosetta Predictions rat pricing
NM_019585 Rosetta Predictions mouse pricing
NM_207687 Rosetta Predictions mouse pricing
NM_207688 Rosetta Predictions mouse pricing
NM_207689 Rosetta Predictions mouse pricing
NM_207690 Rosetta Predictions mouse pricing
NM_207691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084894 predicted 630
2 SASI_Hs01_00084895 predicted 3195
3 SASI_Hs01_00084896 predicted 1124
4 SASI_Hs02_00358901 predicted 1219
5 SASI_Hs02_00358902 predicted 825
6 SASI_Hs02_00358903 predicted 1028
7 SASI_Hs02_00358904 predicted 823
8 SASI_Hs02_00358905 predicted 592
9 SASI_Hs02_00358906 predicted 596
10 SASI_Hs01_00084897 predicted 3008
11 SASI_Hs01_00084898 predicted 3010
12 SASI_Hs01_00084899 predicted 2947
13 SASI_Hs01_00084900 predicted 3010
14 SASI_Hs01_00084901 predicted 2959
15 SASI_Hs01_00084902 predicted 1896
16 SASI_Hs01_00084903 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071997 predicted 2330
2 SASI_Rn01_00071998 predicted 1009
3 SASI_Rn01_00071999 predicted 873
4 SASI_Rn01_00072000 predicted 577
5 SASI_Rn02_00262435 predicted 497
6 SASI_Rn01_00072001 predicted 1035
7 SASI_Rn01_00072002 predicted 442
8 SASI_Rn01_00072003 predicted 2407
9 SASI_Rn01_00072004 predicted 978
10 SASI_Rn02_00262436 predicted 655
11 SASI_Rn01_00072005 predicted 2153
12 SASI_Rn01_00072006 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184343 predicted 865
2 SASI_Mm01_00184344 predicted 882
3 SASI_Mm01_00184345 predicted 886
4 SASI_Mm01_00184346 predicted 878
5 SASI_Mm02_00324649 predicted 890
6 SASI_Mm01_00184347 predicted 889
7 SASI_Mm01_00184348 predicted 882
8 SASI_Mm01_00184349 predicted 886
9 SASI_Mm01_00184350 predicted 860
10 SASI_Mm01_00184351 predicted 230
11 SASI_Mm01_00184352 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058350 predicted 2596
2 SASI_Mm01_00058351 predicted 2623
3 SASI_Mm01_00058352 predicted 2625
4 SASI_Mm01_00058353 predicted 2611
5 SASI_Mm02_00352227 predicted 2628
6 SASI_Mm01_00058354 predicted 2628
7 SASI_Mm01_00058355 predicted 2623
8 SASI_Mm01_00058356 predicted 2624
9 SASI_Mm01_00058357 predicted 2594
10 SASI_Mm01_00058358 predicted 1108
11 SASI_Mm01_00058359 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119571 predicted 1628
2 SASI_Mm01_00119572 predicted 1649
3 SASI_Mm01_00119573 predicted 1656
4 SASI_Mm01_00119574 predicted 1638
5 SASI_Mm02_00352228 predicted 1658
6 SASI_Mm01_00119575 predicted 1660
7 SASI_Mm01_00119576 predicted 1650
8 SASI_Mm01_00119577 predicted 1652
9 SASI_Mm01_00119578 predicted 1628
10 SASI_Mm01_00119580 predicted 131
11 SASI_Mm01_00119579 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157837 predicted 1390
2 SASI_Mm01_00157838 predicted 1412
3 SASI_Mm01_00157839 predicted 1412
4 SASI_Mm01_00157840 predicted 1395
5 SASI_Mm02_00352229 predicted 1423
6 SASI_Mm01_00157841 predicted 1422
7 SASI_Mm01_00157842 predicted 1407
8 SASI_Mm01_00157843 predicted 1409
9 SASI_Mm01_00157844 predicted 1382
10 SASI_Mm01_00157846 predicted 139
11 SASI_Mm01_00157845 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038342 predicted 1354
2 SASI_Mm01_00038343 predicted 1382
3 SASI_Mm01_00038344 predicted 1386
4 SASI_Mm01_00038345 predicted 1373
5 SASI_Mm02_00352230 predicted 1392
6 SASI_Mm01_00038346 predicted 1393
7 SASI_Mm01_00038347 predicted 1378
8 SASI_Mm01_00038348 predicted 1381
9 SASI_Mm01_00038349 predicted 1360
10 SASI_Mm01_00038350 predicted 729
11 SASI_Mm01_00038351 predicted 138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077768 predicted 1606
2 SASI_Mm01_00077769 predicted 1622
3 SASI_Mm01_00077770 predicted 1624
4 SASI_Mm01_00077771 predicted 1618
5 SASI_Mm02_00352231 predicted 1635
6 SASI_Mm01_00077772 predicted 1636
7 SASI_Mm01_00077773 predicted 1625
8 SASI_Mm01_00077774 predicted 1619
9 SASI_Mm01_00077775 predicted 1597
10 SASI_Mm01_00077776 predicted 970
11 SASI_Mm01_00077777 predicted 142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019585
ESPN MISSION shRNA Bacterial Glycerol Stock
espin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-683s1c1
Sequence:CCGGGAGACGAGACATTCTTCGGAACTCGAGTTCCGAAGAATGTCTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-155s1c1
Sequence:CCGGCAGCACCAAATCTTTCAACATCTCGAGATGTTGAAAGATTTGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-158s1c1
Sequence:CCGGCACCAAATCTTTCAACATGATCTCGAGATCATGTTGAAAGATTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-760s21c1
Sequence:CCGGAGGAAATACAGAGGGCGAAAGCTCGAGCTTTCGCCCTCTGTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019585.3-897s21c1
Sequence:CCGGTTGCGTGTAGCCTCACAAGTTCTCGAGAACTTGTGAGGCTACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-201s21c1
Sequence:CCGGGAGCTTCTGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-145s21c1
Sequence:CCGGGCCATATACCCAGCACCAAATCTCGAGATTTGGTGCTGGGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-686s21c1
Sequence:CCGGACGAGACATTCTTCGGAAGAACTCGAGTTCTTCCGAAGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019585
ESPN MISSION shRNA shRNA Plasmid DNA
espin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-683s1c1
Sequence:CCGGGAGACGAGACATTCTTCGGAACTCGAGTTCCGAAGAATGTCTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-155s1c1
Sequence:CCGGCAGCACCAAATCTTTCAACATCTCGAGATGTTGAAAGATTTGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-158s1c1
Sequence:CCGGCACCAAATCTTTCAACATGATCTCGAGATCATGTTGAAAGATTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-760s21c1
Sequence:CCGGAGGAAATACAGAGGGCGAAAGCTCGAGCTTTCGCCCTCTGTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019585.3-897s21c1
Sequence:CCGGTTGCGTGTAGCCTCACAAGTTCTCGAGAACTTGTGAGGCTACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-201s21c1
Sequence:CCGGGAGCTTCTGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-145s21c1
Sequence:CCGGGCCATATACCCAGCACCAAATCTCGAGATTTGGTGCTGGGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-686s21c1
Sequence:CCGGACGAGACATTCTTCGGAAGAACTCGAGTTCTTCCGAAGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019585
ESPN MISSION shRNA Lentiviral Transduction Particles
espin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-683s1c1
Sequence:CCGGGAGACGAGACATTCTTCGGAACTCGAGTTCCGAAGAATGTCTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-155s1c1
Sequence:CCGGCAGCACCAAATCTTTCAACATCTCGAGATGTTGAAAGATTTGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019585.2-158s1c1
Sequence:CCGGCACCAAATCTTTCAACATGATCTCGAGATCATGTTGAAAGATTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-760s21c1
Sequence:CCGGAGGAAATACAGAGGGCGAAAGCTCGAGCTTTCGCCCTCTGTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019585.3-897s21c1
Sequence:CCGGTTGCGTGTAGCCTCACAAGTTCTCGAGAACTTGTGAGGCTACACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-201s21c1
Sequence:CCGGGAGCTTCTGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-145s21c1
Sequence:CCGGGCCATATACCCAGCACCAAATCTCGAGATTTGGTGCTGGGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019585.3-686s21c1
Sequence:CCGGACGAGACATTCTTCGGAAGAACTCGAGTTCTTCCGAAGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031475
ESPN MISSION shRNA Bacterial Glycerol Stock
espin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2628s1c1
Sequence:CCGGGAAGGAACAGTCAGAGAAGCTCTCGAGAGCTTCTCTGACTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1392s1c1
Sequence:CCGGGAGCTACATGGACATGCTGAACTCGAGTTCAGCATGTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-2952s1c1
Sequence:CCGGCTGACGCAAACAACAACAAATCTCGAGATTTGTTGTTGTTTGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-2087s1c1
Sequence:CCGGCCAAGTCTTTCAACATGATGTCTCGAGACATCATGTTGAAAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031475.1-2984s1c1
Sequence:CCGGGCATGCCGACTTACATATATTCTCGAGAATATATGTAAGTCGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-3006s1c1
Sequence:CCGGGCATGTTCGTTGACTATCAAACTCGAGTTTGATAGTCAACGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-455s1c1
Sequence:CCGGGAGTGCAGGACAAAGACAATTCTCGAGAATTGTCTTTGTCCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1575s1c1
Sequence:CCGGCTACATGCAGACCAAGAACAACTCGAGTTGTTCTTGGTCTGCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2084s1c1
Sequence:CCGGGCACCAAGTCTTTCAACATGACTCGAGTCATGTTGAAAGACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031475
ESPN MISSION shRNA shRNA Plasmid DNA
espin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2628s1c1
Sequence:CCGGGAAGGAACAGTCAGAGAAGCTCTCGAGAGCTTCTCTGACTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1392s1c1
Sequence:CCGGGAGCTACATGGACATGCTGAACTCGAGTTCAGCATGTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-2952s1c1
Sequence:CCGGCTGACGCAAACAACAACAAATCTCGAGATTTGTTGTTGTTTGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-2087s1c1
Sequence:CCGGCCAAGTCTTTCAACATGATGTCTCGAGACATCATGTTGAAAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031475.1-2984s1c1
Sequence:CCGGGCATGCCGACTTACATATATTCTCGAGAATATATGTAAGTCGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-3006s1c1
Sequence:CCGGGCATGTTCGTTGACTATCAAACTCGAGTTTGATAGTCAACGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-455s1c1
Sequence:CCGGGAGTGCAGGACAAAGACAATTCTCGAGAATTGTCTTTGTCCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1575s1c1
Sequence:CCGGCTACATGCAGACCAAGAACAACTCGAGTTGTTCTTGGTCTGCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2084s1c1
Sequence:CCGGGCACCAAGTCTTTCAACATGACTCGAGTCATGTTGAAAGACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031475
ESPN MISSION shRNA Lentiviral Transduction Particles
espin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2628s1c1
Sequence:CCGGGAAGGAACAGTCAGAGAAGCTCTCGAGAGCTTCTCTGACTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1392s1c1
Sequence:CCGGGAGCTACATGGACATGCTGAACTCGAGTTCAGCATGTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-2952s1c1
Sequence:CCGGCTGACGCAAACAACAACAAATCTCGAGATTTGTTGTTGTTTGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-2087s1c1
Sequence:CCGGCCAAGTCTTTCAACATGATGTCTCGAGACATCATGTTGAAAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031475.1-2984s1c1
Sequence:CCGGGCATGCCGACTTACATATATTCTCGAGAATATATGTAAGTCGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031475.1-3006s1c1
Sequence:CCGGGCATGTTCGTTGACTATCAAACTCGAGTTTGATAGTCAACGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-455s1c1
Sequence:CCGGGAGTGCAGGACAAAGACAATTCTCGAGAATTGTCTTTGTCCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031475.1-1575s1c1
Sequence:CCGGCTACATGCAGACCAAGAACAACTCGAGTTGTTCTTGGTCTGCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031475.1-2084s1c1
Sequence:CCGGGCACCAAGTCTTTCAACATGACTCGAGTCATGTTGAAAGACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks