EMAIL THIS PAGE TO A FRIEND

ESPNL

espin-like

60 Gene Product Result for
UniProtKB ID: Q6ZVH7, Q66K27, Q6ZVG1, Q8IVU2
Gene ID:
Mouse(227357) espin-like
Rat(301606) espin-like
chicken(770264) espin-like
cow(524380) espin-like
dog(486178) espin-like
chicken(101749564) espin-like
chicken(101665734) espin-like
sheep(101109851) espin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194312 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194531 MISSION® esiRNA esiRNA targeting mouse Espnl mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194312 Rosetta Predictions human pricing
XM_237393 Rosetta Predictions rat pricing
XR_008397 Rosetta Predictions rat pricing
NM_001033292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120452 predicted 3036
2 SASI_Hs01_00120453 predicted 3503
3 SASI_Hs01_00120454 predicted 1631
4 SASI_Hs01_00120456 predicted 2367
5 SASI_Hs01_00120458 predicted 3091
6 SASI_Hs01_00120455 predicted 3128
7 SASI_Hs01_00120459 predicted 795
8 SASI_Hs01_00120460 predicted 3263
9 SASI_Hs01_00120461 predicted 1616
10 SASI_Hs02_00371446 predicted 3102
11 SASI_Hs01_00120457 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390867 predicted 1975
2 SASI_Rn02_00390868 predicted 199
3 SASI_Rn02_00390869 predicted 1667
4 SASI_Rn02_00390870 predicted 2667
5 SASI_Rn02_00390871 predicted 1851
6 SASI_Rn02_00390872 predicted 2652
7 SASI_Rn02_00390873 predicted 1671
8 SASI_Rn02_00390874 predicted 231
9 SASI_Rn02_00390875 predicted 2033
10 SASI_Rn02_00390876 predicted 2234
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191794 predicted 1902
2 SASI_Rn02_00416934 predicted 1599
3 SASI_Rn02_00416935 predicted 2596
4 SASI_Rn01_00191800 predicted 1782
5 SASI_Rn01_00191801 predicted 2585
6 SASI_Rn01_00191802 predicted 1605
7 SASI_Rn01_00191803 predicted 1959
8 SASI_Rn02_00416936 predicted 2536
9 SASI_Rn02_00416937 predicted 2164
10 SASI_Rn02_00416938 predicted 212
11 SASI_Rn01_00191795 predicted 908
12 SASI_Rn01_00191796 predicted 803
13 SASI_Rn01_00191797 predicted 576
14 SASI_Rn01_00191798 predicted 1406
15 SASI_Rn01_00191799 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288493 predicted 708
2 SASI_Mm01_00078103 predicted 203
3 SASI_Mm01_00078104 predicted 2031
4 SASI_Mm01_00078105 predicted 970
5 SASI_Mm01_00078107 predicted 1498
6 SASI_Mm01_00078108 predicted 577
7 SASI_Mm01_00078109 predicted 807
8 SASI_Mm01_00078110 predicted 873
9 SASI_Mm01_00078111 predicted 485
10 SASI_Mm01_00078112 predicted 208
11 SASI_Mm01_00078106 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033292
ESPNL MISSION shRNA Bacterial Glycerol Stock
espin-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1558s21c1
Sequence:CCGGGACGGAGGATGATCTTGTATACTCGAGTATACAAGATCATCCTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-104s21c1
Sequence:CCGGGCCACCTTGGAACGGCTATTTCTCGAGAAATAGCCGTTCCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033292.3-4755s21c1
Sequence:CCGGTGACCCGAAAGCCCGTGAATACTCGAGTATTCACGGGCTTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1997s21c1
Sequence:CCGGGGAGTGTCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGACACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1495s21c1
Sequence:CCGGACAGGCAACTTGGAGATATTCCTCGAGGAATATCTCCAAGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033292
ESPNL MISSION shRNA shRNA Plasmid DNA
espin-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1558s21c1
Sequence:CCGGGACGGAGGATGATCTTGTATACTCGAGTATACAAGATCATCCTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-104s21c1
Sequence:CCGGGCCACCTTGGAACGGCTATTTCTCGAGAAATAGCCGTTCCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033292.3-4755s21c1
Sequence:CCGGTGACCCGAAAGCCCGTGAATACTCGAGTATTCACGGGCTTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1997s21c1
Sequence:CCGGGGAGTGTCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGACACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1495s21c1
Sequence:CCGGACAGGCAACTTGGAGATATTCCTCGAGGAATATCTCCAAGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033292
ESPNL MISSION shRNA Lentiviral Transduction Particles
espin-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1558s21c1
Sequence:CCGGGACGGAGGATGATCTTGTATACTCGAGTATACAAGATCATCCTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-104s21c1
Sequence:CCGGGCCACCTTGGAACGGCTATTTCTCGAGAAATAGCCGTTCCAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033292.3-4755s21c1
Sequence:CCGGTGACCCGAAAGCCCGTGAATACTCGAGTATTCACGGGCTTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1997s21c1
Sequence:CCGGGGAGTGTCAGTTCGGACATTGCTCGAGCAATGTCCGAACTGACACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033292.3-1495s21c1
Sequence:CCGGACAGGCAACTTGGAGATATTCCTCGAGGAATATCTCCAAGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194312
ESPNL MISSION shRNA Bacterial Glycerol Stock
espin-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3027s1c1
Sequence:CCGGGCTGAGATGTTCAACTTTGGACTCGAGTCCAAAGTTGAACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3014s1c1
Sequence:CCGGGAAGGAGAAAGAAGCTGAGATCTCGAGATCTCAGCTTCTTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194312.1-3440s1c1
Sequence:CCGGCCATCTTTCATGTGAGTCTGACTCGAGTCAGACTCACATGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3030s1c1
Sequence:CCGGGAGATGTTCAACTTTGGAGAACTCGAGTTCTCCAAAGTTGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3024s1c1
Sequence:CCGGGAAGCTGAGATGTTCAACTTTCTCGAGAAAGTTGAACATCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194312
ESPNL MISSION shRNA shRNA Plasmid DNA
espin-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3027s1c1
Sequence:CCGGGCTGAGATGTTCAACTTTGGACTCGAGTCCAAAGTTGAACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3014s1c1
Sequence:CCGGGAAGGAGAAAGAAGCTGAGATCTCGAGATCTCAGCTTCTTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194312.1-3440s1c1
Sequence:CCGGCCATCTTTCATGTGAGTCTGACTCGAGTCAGACTCACATGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3030s1c1
Sequence:CCGGGAGATGTTCAACTTTGGAGAACTCGAGTTCTCCAAAGTTGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3024s1c1
Sequence:CCGGGAAGCTGAGATGTTCAACTTTCTCGAGAAAGTTGAACATCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194312
ESPNL MISSION shRNA Lentiviral Transduction Particles
espin-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3027s1c1
Sequence:CCGGGCTGAGATGTTCAACTTTGGACTCGAGTCCAAAGTTGAACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3014s1c1
Sequence:CCGGGAAGGAGAAAGAAGCTGAGATCTCGAGATCTCAGCTTCTTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194312.1-3440s1c1
Sequence:CCGGCCATCTTTCATGTGAGTCTGACTCGAGTCAGACTCACATGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3030s1c1
Sequence:CCGGGAGATGTTCAACTTTGGAGAACTCGAGTTCTCCAAAGTTGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194312.1-3024s1c1
Sequence:CCGGGAAGCTGAGATGTTCAACTTTCTCGAGAAAGTTGAACATCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks