EMAIL THIS PAGE TO A FRIEND

ESR1

estrogen receptor 1

416 Gene Product Result for
Synonyms: ER ESR ESRA ESTRR Era NR3A1
Gene ID:
Human(2099) Summary: This gene encodes an estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. The protein localizes to the nucleus where it may form a homodimer or a heterodimer with estrogen receptor 2. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Estrogen receptors are also involved in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in several transcript variants, which differ in their 5' UTRs and use different promoters. [provided by RefSeq, Jul 2008]
Mouse(13982) estrogen receptor 1 (alpha)
Rat(24890) estrogen receptor 1
Goat(100860768) estrogen receptor 1
sheep(443228) estrogen receptor 1
domestic guinea pig(100713276) estrogen receptor 1
Zebrafish(259252) estrogen receptor 1
dog(403640) estrogen receptor 1
cow(407238) estrogen receptor 1
Horse(791249) estrogen receptor 1
domestic cat(552888) estrogen receptor 1
chicken(396099) estrogen receptor 1
Thale Cress(837856) ethylene-responsive transcription factor ESR1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300344 Anti-ESR1 (Ab-104) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300345 Anti-ESR1 (Ab-106) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300346 Anti-ESR1 (Ab-118) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300347 Anti-ESR1 (Ab-167) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100711 Anti-ESR1 (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2100712 Anti-ESR1 (ab2) antibody produced in rabbit affinity isolated antibody human, pig, canine, bovine
western blot pricing
GW21182 Anti-ESR1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
HPA000449 Anti-ESR1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA000450 Anti-ESR1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1306161 ANTI-ESR1 ISOFORM1 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1305944 ANTI-ESR1 ISOFORM1 (N-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB1305938 ANTI-ESR1 ISOFORM4 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306666 ANTI-ESR1 ISOFORM4 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2104971 Anti-ESR1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit
western blot pricing
E1396 Anti-Estrogen Receptor (154-171) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
E0521 Anti-Estrogen Receptor (18-32) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
E0646 Anti-Estrogen Receptor (578-595) antibody produced in rabbit whole antiserum human
western blot pricing
SAB5500101 Anti-Estrogen Receptor antibody, Rabbit monoclonal clone SP1, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry, western blot pricing
SAB4500810 Anti-Estrogen Receptor-α antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500811 Anti-Estrogen Receptor-α antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500812 Anti-Estrogen Receptor-α antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500813 Anti-Estrogen Receptor-α antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4500809 Anti-Estrogen Receptor-α, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300052 Anti-phospho-ESR1 (pSer104) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300053 Anti-phospho-ESR1 (pSer106) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300054 Anti-phospho-ESR1 (pSer118) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300055 Anti-phospho-ESR1 (pSer167) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4301359 Anti-phospho-Estrogen Receptor-α (pSer102) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4504397 Anti-phospho-Estrogen Receptor-α (pSer104) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504398 Anti-phospho-Estrogen Receptor-α (pSer106) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504399 Anti-phospho-Estrogen Receptor-α (pSer118) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
E7905 Anti-phospho-Estrogen Receptor-α (pSer167) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing
SAB4504400 Anti-phospho-Estrogen Receptor-α (pSer167) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504177 Anti-phospho-Estrogen Receptor-α (pSer305) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
SAB4503910 Anti-phospho-Estrogen Receptor-α (pTyr537) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301234 Anti-phospho-Estrogen Receptor-α (pTyr537) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4800040 Imprint® Monoclonal Anti-ERa antibody produced in mouse purified antibody, buffered aqueous solution human
ChIP, immunohistochemistry, western blot pricing
AMAB90867 Monoclonal Anti-ESR1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1196, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1402766 Monoclonal Anti-ESR1 antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300303 Monoclonal Anti-ESR1 antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300304 Monoclonal Anti-ESR1 antibody produced in mouse clone 5D4B1, ascites fluid human
ELISA, western blot pricing
SAB5300305 Monoclonal Anti-ESR1 antibody produced in mouse clone 10H12B10, ascites fluid human
ELISA, western blot pricing
SAB5300306 Monoclonal Anti-ESR1 antibody produced in mouse clone 8H9A10, ascites fluid human
ELISA, western blot pricing
SAB5300307 Monoclonal Anti-ESR1 antibody produced in mouse clone 2G112B3, ascites fluid human
ELISA, western blot pricing
SAB5300308 Monoclonal Anti-ESR1 antibody produced in mouse clone 6B6, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0113 Rabbit anti-Estrogen Receptor Alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gibbon, gibbon, chimpanzee, primate
immunoprecipitation, proximity ligation assay, western blot pricing
PLA0121 Rabbit anti-Phospho Estrogen Receptor Alpha (S305) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
proximity ligation assay, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M6383 2-Methoxyestradiol powder human pricing
643998 3-(4-Hydroxyphenyl)benzonitrile 97% human pricing
374784 4′-Hydroxy-4-biphenylcarbonitrile 97% human pricing
168734 4,4′-Dihydroxybiphenyl 97% human pricing
A8380 5α-Androstan-17β-ol-3-one ≥97.5% human, mouse, rat pricing
31573 5α-Androstan-17β-ol-3-one VETRANAL, analytical standard human, mouse, rat pricing
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing
E8875 β-Estradiol ≥98% human, mouse, rat pricing
E2758 β-Estradiol BioReagent, powder, suitable for cell culture human, mouse, rat pricing
E2257 β-Estradiol powder, γ-irradiated, suitable for cell culture human, mouse, rat pricing
E1132 β-Estradiol analytical standard human, mouse, rat pricing
27883 Coumestrol BioReagent, suitable for fluorescence, ≥97.5% (HPLC) human, mouse, rat pricing
27885 Coumestrol ≥95.0% (HPLC) human, mouse, rat pricing
D7802 Daidzein ≥98%, synthetic human, mouse, rat pricing
D4628 Diethylstilbestrol ≥99% (HPLC) human, mouse, rat pricing
46207 Diethylstilbestrol VETRANAL, analytical standard human, mouse, rat pricing
218944 Diethylstilbestrol, mixture of cis and trans 97% human, mouse, rat pricing
E1024 Estradiol meets USP testing specifications human, mouse, rat pricing
E1253 Estriol ≥97% human, mouse, rat pricing
E1149 Estriol meets USP testing specifications human, mouse, rat pricing
46565 Estriol VETRANAL, analytical standard human, mouse, rat pricing
E9750 Estrone ≥99% human, mouse, rat pricing
E1274 Estrone meets USP testing specifications human, mouse, rat pricing
46573 Estrone VETRANAL, analytical standard human, mouse, rat pricing
G6649 Genistein synthetic, ≥98% (HPLC), powder human, mouse, rat pricing
G6776 Genistein from Glycine max (soybean), ~98% (HPLC) human, mouse, rat pricing
M8046 Mifepristone ≥98% human, mouse, rat pricing
P6004 Prednisolone ≥99% human, mouse, rat pricing
46656 Prednisolone VETRANAL, analytical standard human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
R5010 Resveratrol ≥99% (HPLC) human, mouse, rat pricing
T1500 Testosterone ≥98% human, mouse, rat pricing
46923 Testosterone VETRANAL, analytical standard human, mouse, rat pricing
T5411 Testosterone solution 1.0 mg/mL in 1,2-dimethoxyethane, drug standard human, mouse, rat pricing
H7904 (Z)-4-Hydroxytamoxifen ≥98% Z isomer human, rat pricing
H6278 4-Hydroxytamoxifen ≥70% Z isomer (remainder primarily E-isomer) human, rat pricing
T176 4-Hydroxytamoxifen analytical standard, (E) and (Z) isomers (50:50) human, rat pricing
S4808 cis-Stilbene 96% human, rat pricing
H7753 Hexestrol analytical standard human, rat pricing
46320 Hexestrol VETRANAL, analytical standard human, rat pricing
T5648 Tamoxifen ≥99% human, rat pricing
262013 trans-4-Stilbenemethanol human, rat pricing
139939 trans-Stilbene 96% human, rat pricing
BCR297 2,2′,4,4′,5,5′-Hexachlorobiphenyl (IUPAC No. 153) BCR® certified Reference Material mouse pricing
BCR293 2,2′,5,5′-Tetrachlorobiphenyl (IUPAC No. 52) BCR® certified Reference Material mouse pricing
C33301 2-Chloro-4,6-diamino-1,3,5-triazine 95% mouse pricing
MET58C 2-Chloro-4,6-diamino-1,3,5-triazine analytical standard mouse pricing
B99405 2-tert-Butylphenol 99% mouse pricing
323616 3′-Deoxythymidine 98% mouse pricing
124281 3-tert-Butylphenol 99% mouse pricing
290823 4-tert-Octylphenol 97% mouse pricing
442858 4-tert-Octylphenol analytical standard mouse pricing
45330 Atrazine PESTANAL®, analytical standard mouse pricing
49085 Atrazine analytical standard mouse pricing
PS380 Atrazine analytical standard mouse pricing
PS380-250MG Atrazine analytical standard mouse pricing
48187 Atrazine solution certified reference material, 1000 μg/mL in methyl tert-butyl ether mouse pricing
36667 Atrazine-desethyl-desisopropyl PESTANAL®, analytical standard mouse pricing
36927 Benzyl butyl phthalate analytical standard mouse pricing
308501 Benzyl butyl phthalate 98% mouse pricing
442503 Benzyl butyl phthalate analytical standard mouse pricing
D2270 Dibutyl phthalate mouse pricing
152439 Dibutyl phthalate ReagentPlus®, ≥99% mouse pricing
524980 Dibutyl phthalate 99% mouse pricing
80100 Dibutyl phthalate Selectophore mouse pricing
36736 Dibutyl phthalate PESTANAL®, analytical standard mouse pricing
36161 Methoxychlor PESTANAL®, analytical standard mouse pricing
49054 Methoxychlor analytical standard mouse pricing
45705 Vinclozolin PESTANAL®, analytical standard mouse pricing
Z2125 Zearalenone fungal mycotoxin mouse pricing
34126 Zearalenone solution 100 μg/mL in acetonitrile, analytical standard mouse pricing
B39607 1,1-Dichloro-2,2-bis(4-chlorophenyl)ethane technical grade mouse, rat pricing
123897 1,1-Dichloro-2,2-bis(4-chlorophenyl)ethene 99% mouse, rat pricing
49018 2,4′-DDT analytical standard mouse, rat pricing
35486 4,4′-DDD PESTANAL®, analytical standard mouse, rat pricing
45837 4,4′-DDD solution PESTANAL®, analytical standard, 100 ng/μL in methanol mouse, rat pricing
40092 4,4′-DDD solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
35487 4,4′-DDE PESTANAL®, analytical standard mouse, rat pricing
48968 4,4′-DDE solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
40091 4,4′-DDE solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
48679 4,4′-DDE solution 20 μg/mL in methanol, analytical standard mouse, rat pricing
386340 4,4′-DDT 98% mouse, rat pricing
36662 4,4′-DDT solution 100 ng/μL in methanol, PESTANAL®, analytical standard mouse, rat pricing
48980 4,4′-DDT solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
40124 4,4′-DDT solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
46405 4-Nonylphenol PESTANAL®, analytical standard mouse, rat pricing
442873 4-Nonylphenol analytical standard mouse, rat pricing
425761 4-tert-Butylphenol purified by sublimation, 99% mouse, rat pricing
W391808 4-tert-Butylphenol ≥99%, FG mouse, rat pricing
B99901 4-tert-Butylphenol 99% mouse, rat pricing
506761 4-tert-Butylphenol analytical standard mouse, rat pricing
239658 Bisphenol A ≥99% mouse, rat pricing
133027 Bisphenol A 97% mouse, rat pricing
32015 Endosulfan PESTANAL®, analytical standard mouse, rat pricing
49049 γ-BHC analytical standard mouse, rat pricing
233390 Lindane 97% mouse, rat pricing
45548 Lindane PESTANAL®, analytical standard mouse, rat pricing
48982 Methoxychlor solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
290858 Nonylphenol technical grade, mixture of ring and chain isomers mouse, rat pricing
46018 Nonylphenol PESTANAL®, analytical standard, technical mixture mouse, rat pricing
181641 Poly(Bisphenol A carbonate) analytical standard mouse, rat pricing
181676 Poly(Bisphenol A carbonate) analytical standard, molecular weight series mouse, rat pricing
181625 Poly(Bisphenol A carbonate) average Mw ~45,000 by GPC mouse, rat pricing
435139 Poly(Bisphenol A carbonate) melt index 10-12 g/10 min (300°C/1.2kg) mouse, rat pricing
E4876 17α-Ethynylestradiol ≥98% rat pricing
46263 17α-Ethynylestradiol VETRANAL, analytical standard rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F7751 Fluoxymesterone solid (photosensitive) human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
E8750 α-Estradiol powder, ≥98% (TLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141651 MISSION® esiRNA esiRNA human ESR1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB447 Anti-ER-alpha Antibody, clone AER314 100 µL, Use Anti-ER-alpha Antibody, clone AER314 (Mouse Monoclonal Antibody) validated in IP, WB, IHC(P) to detect Estrogen Receptor α also known as ER, ER1, Estradiol Receptor, ER-alpha. pricing
06-935 Anti-Estrogen Receptor α Antibody 100 µg, Anti-Estrogen Receptor α Antibody is a Rabbit Polyclonal Antibody for detection of Estrogen Receptor α also known as Estrogen receptor-like 1, Estrogen-related receptor alpha & has been validated in EMSA, ICC, IHC, IP & WB. pricing
MAB443 Anti-Estrogen Receptor Antibody, clone AER304 100 µL, Anti-Estrogen Receptor Antibody, clone AER304 is a Mouse Monoclonal Antibody for detection of Estrogen Receptor also known as ER & has been validated in EMSA, IP, WB & IHC. pricing
04-1564 Anti-Estrogen Receptor α Antibody, clone F3-A 100 µL, Anti-Estrogen Receptor α Antibody, clone F3-A is a mouse monoclonal antibody for detection of Estrogen Receptor α also known as Estradiol receptor & Nuclear receptor subfamily 3 group A member 1 has been validated in WB, ICC. pricing
07-662 Anti-Estrogen-related Receptor α Antibody 100 µg, Anti-Estrogen-related Receptor α Antibody is a Rabbit Polyclonal Antibody for detection of Estrogen-related Receptor α also known as ERR alpha & has been tested in EMSA, IHC, IP & WB. pricing
05-793 Anti-phospho-Estrogen Receptor alpha (Ser118) Antibody, clone NL44, rabbit monoclonal 100 µL, Anti-phospho-Estrogen Receptor alpha (Ser118) Antibody, clone NL44 is a Rabbit Monoclonal Antibody for detection of ER alpha also known as Estrogen receptor alpha & has been tested in WB. pricing
07-962 Anti-phospho-Estrogen Receptor α (Ser305) Antibody 100 µg, Anti-phospho-Estrogen Receptor α (Ser305) Antibody is an antibody against phospho-Estrogen Receptor α (Ser305) for use in IH(P). pricing
17-603 ChIPAb+ Estrogen Receptor α - ChIP Validated Antibody and Primer Set 25 assays, This ChIPAb+ Estrogen Receptor α -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000125 Rosetta Predictions human pricing
NM_001122740 Rosetta Predictions human pricing
NM_001122741 Rosetta Predictions human pricing
NM_001122742 Rosetta Predictions human pricing
NM_012689 Rosetta Predictions rat pricing
XM_579343 Rosetta Predictions rat pricing
NM_007956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078592 predicted 1564
2 SASI_Hs01_00078593 predicted 1204
3 SASI_Hs01_00078594 predicted 714
4 SASI_Hs01_00078595 predicted 957
5 SASI_Hs01_00078596 predicted 1674
6 SASI_Hs01_00078597 predicted 877
7 SASI_Hs01_00078598 predicted 2046
8 SASI_Hs01_00078599 predicted 1371
9 SASI_Hs01_00078600 predicted 1013
10 SASI_Hs01_00078601 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327255 predicted 1583
2 SASI_Hs02_00327256 predicted 1230
3 SASI_Hs02_00327257 predicted 743
4 SASI_Hs02_00327258 predicted 982
5 SASI_Hs02_00327259 predicted 1703
6 SASI_Hs02_00327260 predicted 906
7 SASI_Hs02_00327261 predicted 2070
8 SASI_Hs02_00327262 predicted 1389
9 SASI_Hs02_00327263 predicted 1036
10 SASI_Hs02_00327264 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327265 predicted 1544
2 SASI_Hs02_00327266 predicted 1184
3 SASI_Hs02_00327267 predicted 695
4 SASI_Hs02_00327268 predicted 946
5 SASI_Hs02_00327269 predicted 1660
6 SASI_Hs02_00327270 predicted 862
7 SASI_Hs02_00327271 predicted 2029
8 SASI_Hs02_00327272 predicted 1355
9 SASI_Hs02_00327273 predicted 994
10 SASI_Hs02_00327274 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327275 predicted 1698
2 SASI_Hs02_00327276 predicted 1338
3 SASI_Hs02_00327277 predicted 852
4 SASI_Hs02_00327278 predicted 1097
5 SASI_Hs02_00327279 predicted 1812
6 SASI_Hs02_00327280 predicted 1017
7 SASI_Hs02_00327281 predicted 2179
8 SASI_Hs02_00327282 predicted 1502
9 SASI_Hs02_00327283 predicted 1149
10 SASI_Hs02_00327284 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068533 predicted 1803
2 SASI_Rn01_00068534 predicted 1458
3 SASI_Rn01_00068535 predicted 1670
4 SASI_Rn01_00068536 predicted 1057
5 SASI_Rn01_00068537 predicted 1816
6 SASI_Rn01_00068538 predicted 1175
7 SASI_Rn01_00068540 predicted 1496
8 SASI_Rn01_00068541 predicted 876
9 SASI_Rn01_00068542 predicted 1197
10 SASI_Rn02_00259998 predicted 956
11 SASI_Rn01_00068539 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161063 predicted 1340
2 SASI_Rn01_00161064 predicted 1190
3 SASI_Rn01_00161065 predicted 1222
4 SASI_Rn01_00161066 predicted 1241
5 SASI_Rn01_00161067 predicted 1182
6 SASI_Rn01_00161068 predicted 1278
7 SASI_Rn01_00161069 predicted 1325
8 SASI_Rn01_00161070 predicted 1172
9 SASI_Rn01_00161071 predicted 1165
10 SASI_Rn01_00161072 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108712 predicted 1237
2 SASI_Mm01_00108714 predicted 1164
3 SASI_Mm01_00108715 predicted 1642
4 SASI_Mm01_00108716 predicted 1470
5 SASI_Mm01_00108718 predicted 841
6 SASI_Mm01_00108719 predicted 1167
7 SASI_Mm01_00108720 predicted 921
8 SASI_Mm02_00312830 predicted 739
9 SASI_Mm01_00108721 predicted 2039
10 SASI_Mm02_00312831 predicted 1406
11 SASI_Mm01_00108713 predicted 1194
12 SASI_Mm01_00108717 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000125
VALIDATED
ESR1 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000003300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000125.x-807s1c1
Sequence:CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGCCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000125.x-2076s1c1
Sequence:CCGGCTCTACTTCATCGCATTCCTTCTCGAGAAGGAATGCGATGAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000125.x-3185s1c1
Sequence:CCGGGCAGGATTGTTGTGGCTACTACTCGAGTAGTAGCCACAACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000125
VALIDATED
ESR1 MISSION shRNA shRNA Plasmid DNA
estrogen receptor 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000003300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000125.x-807s1c1
Sequence:CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGCCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000125.x-2076s1c1
Sequence:CCGGCTCTACTTCATCGCATTCCTTCTCGAGAAGGAATGCGATGAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000125.x-3185s1c1
Sequence:CCGGGCAGGATTGTTGTGGCTACTACTCGAGTAGTAGCCACAACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000125
VALIDATED
ESR1 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000003300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000125.x-807s1c1
Sequence:CCGGCTACAGGCCAAATTCAGATAACTCGAGTTATCTGAATTTGGCCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000125.x-2076s1c1
Sequence:CCGGCTCTACTTCATCGCATTCCTTCTCGAGAAGGAATGCGATGAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000125.x-3185s1c1
Sequence:CCGGGCAGGATTGTTGTGGCTACTACTCGAGTAGTAGCCACAACAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007956
VALIDATED
ESR1 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1021s1c1
Sequence:CCGGGCCGAAATGAAATGGGTGCTTCTCGAGAAGCACCCATTTCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1167s1c1
Sequence:CCGGCCCATGATCTATTCTGAATATCTCGAGATATTCAGAATAGATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-634s1c1
Sequence:CCGGCCGCCTTCTACAGGTCTAATTCTCGAGAATTAGACCTGTAGAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007956.2-4010s1c1
Sequence:CCGGCGTGTCATGTATGCAGTTATTCTCGAGAATAACTGCATACATGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007956.2-813s1c1
Sequence:CCGGGCTTTCTTTAAGAGAAGCATTCTCGAGAATGCTTCTCTTAAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007956
VALIDATED
ESR1 MISSION shRNA shRNA Plasmid DNA
estrogen receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1021s1c1
Sequence:CCGGGCCGAAATGAAATGGGTGCTTCTCGAGAAGCACCCATTTCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1167s1c1
Sequence:CCGGCCCATGATCTATTCTGAATATCTCGAGATATTCAGAATAGATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-634s1c1
Sequence:CCGGCCGCCTTCTACAGGTCTAATTCTCGAGAATTAGACCTGTAGAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007956.2-4010s1c1
Sequence:CCGGCGTGTCATGTATGCAGTTATTCTCGAGAATAACTGCATACATGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007956.2-813s1c1
Sequence:CCGGGCTTTCTTTAAGAGAAGCATTCTCGAGAATGCTTCTCTTAAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007956
VALIDATED
ESR1 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1021s1c1
Sequence:CCGGGCCGAAATGAAATGGGTGCTTCTCGAGAAGCACCCATTTCATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-1167s1c1
Sequence:CCGGCCCATGATCTATTCTGAATATCTCGAGATATTCAGAATAGATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007956.2-634s1c1
Sequence:CCGGCCGCCTTCTACAGGTCTAATTCTCGAGAATTAGACCTGTAGAAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007956.2-4010s1c1
Sequence:CCGGCGTGTCATGTATGCAGTTATTCTCGAGAATAACTGCATACATGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007956.2-813s1c1
Sequence:CCGGGCTTTCTTTAAGAGAAGCATTCTCGAGAATGCTTCTCTTAAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks