EMAIL THIS PAGE TO A FRIEND

ESR2

estrogen receptor 2 (ER beta)

164 Gene Product Result for
Synonyms: ER-BETA ESR-BETA ESRB ESTRB Erb NR3A2
Gene ID:
Human(2100) Summary: This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(13983) estrogen receptor 2 (beta)
Rat(25149) estrogen receptor 2 (ER beta)
chicken(395575) estrogen receptor 2 (ER beta)
dog(403639) estrogen receptor 2 (ER beta)
Horse(100033964) estrogen receptor 2 (ER beta)
cow(281146) estrogen receptor 2 (ER beta)
domestic cat(101086317) estrogen receptor 2 (ER beta)
domestic guinea pig(100731304) estrogen receptor 2 (ER beta)
Goat(100860823) estrogen receptor 2 (ER beta)
Domestic Rabbit(100346748) estrogen receptor 2 (ER beta)
sheep(443066) estrogen receptor 2 (ER beta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22678 Anti-ERB antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB2502079 Anti-ESR2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AV31652 Anti-ESR2 antibody produced in rabbit affinity isolated antibody goat, human, mouse, canine, rabbit, pig, bovine, guinea pig, horse, rat, sheep
western blot pricing
SAB2100713 Anti-ESR2 antibody produced in rabbit affinity isolated antibody human, rat, mouse, horse, bovine, sheep, guinea pig, rabbit, goat
western blot pricing
SAB2105299 Anti-ESR2, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB4500814 Anti-Estrogen Receptor-β antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4504683 Anti-phospho-Estrogen Receptor- (pSer87) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4504178 Anti-phospho-Estrogen Receptor-β (pSer105) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4301494 Anti-phospho-Estrogen Receptor-β (pSer105) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
WH0002100M1 Monoclonal Anti-ESR2 antibody produced in mouse clone 3F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2702145 Monoclonal Anti-ESR2 antibody produced in mouse human, mouse
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702146 Monoclonal Anti-ESR2 antibody produced in mouse human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702147 Monoclonal Anti-ESR2 antibody produced in mouse human
ChIP, immunoprecipitation, western blot pricing
E1276 Monoclonal Anti-Estrogen Receptor β antibody produced in mouse clone 9.88, ascites fluid human, mouse, rat
immunoprecipitation, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
E9750 Estrone ≥99% human, mouse, rat pricing
E1274 Estrone meets USP testing specifications human, mouse, rat pricing
46573 Estrone VETRANAL, analytical standard human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M6383 2-Methoxyestradiol powder human pricing
643998 3-(4-Hydroxyphenyl)benzonitrile 97% human pricing
374784 4′-Hydroxy-4-biphenylcarbonitrile 97% human pricing
168734 4,4′-Dihydroxybiphenyl 97% human pricing
E8875 β-Estradiol ≥98% human, mouse, rat pricing
E2758 β-Estradiol BioReagent, powder, suitable for cell culture human, mouse, rat pricing
E2257 β-Estradiol powder, γ-irradiated, suitable for cell culture human, mouse, rat pricing
E1132 β-Estradiol analytical standard human, mouse, rat pricing
27883 Coumestrol BioReagent, suitable for fluorescence, ≥97.5% (HPLC) human, mouse, rat pricing
27885 Coumestrol ≥95.0% (HPLC) human, mouse, rat pricing
D7802 Daidzein ≥98%, synthetic human, mouse, rat pricing
D4628 Diethylstilbestrol ≥99% (HPLC) human, mouse, rat pricing
46207 Diethylstilbestrol VETRANAL, analytical standard human, mouse, rat pricing
E1024 Estradiol meets USP testing specifications human, mouse, rat pricing
G6649 Genistein synthetic, ≥98% (HPLC), powder human, mouse, rat pricing
G6776 Genistein from Glycine max (soybean), ~98% (HPLC) human, mouse, rat pricing
M8046 Mifepristone ≥98% human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
46665 Progesterone VETRANAL, analytical standard human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
H7904 (Z)-4-Hydroxytamoxifen ≥98% Z isomer human, rat pricing
H6278 4-Hydroxytamoxifen ≥70% Z isomer (remainder primarily E-isomer) human, rat pricing
T176 4-Hydroxytamoxifen analytical standard, (E) and (Z) isomers (50:50) human, rat pricing
T5648 Tamoxifen ≥99% human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
218944 Diethylstilbestrol, mixture of cis and trans 97% human, mouse, rat pricing
E8750 α-Estradiol powder, ≥98% (TLC) human, rat pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1075 MCF10A CELLS ESR2 (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040275 Rosetta Predictions human pricing
NM_001040276 Rosetta Predictions human pricing
NM_001437 Rosetta Predictions human pricing
NM_012754 Rosetta Predictions rat pricing
NM_010157 Rosetta Predictions mouse pricing
NM_207707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308926 predicted 1079
2 SASI_Hs01_00154421 predicted 812
3 SASI_Hs01_00154423 predicted 691
4 SASI_Hs01_00154424 predicted 1606
5 SASI_Hs01_00154425 predicted 1527
6 SASI_Hs01_00154426 predicted 916
7 SASI_Hs01_00154427 predicted 1385
8 SASI_Hs01_00154428 predicted 867
9 SASI_Hs01_00154429 predicted 738
10 SASI_Hs01_00154430 predicted 1359
11 SASI_Hs01_00154422 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308927 predicted 1360
2 SASI_Hs01_00038553 predicted 1086
3 SASI_Hs01_00038555 predicted 968
4 SASI_Hs01_00038556 predicted 1884
5 SASI_Hs01_00038557 predicted 1800
6 SASI_Hs01_00038558 predicted 1191
7 SASI_Hs01_00038559 predicted 1660
8 SASI_Hs01_00038560 predicted 1145
9 SASI_Hs01_00038561 predicted 1018
10 SASI_Hs01_00038562 predicted 1636
11 SASI_Hs01_00038554 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331844 predicted 1080
2 SASI_Hs01_00032659 predicted 811
3 SASI_Hs01_00032661 predicted 684
4 SASI_Hs01_00032662 predicted 1614
5 SASI_Hs01_00032663 predicted 1528
6 SASI_Hs01_00032664 predicted 919
7 SASI_Hs01_00032665 predicted 1387
8 SASI_Hs01_00032666 predicted 869
9 SASI_Hs01_00032667 predicted 738
10 SASI_Hs01_00032668 predicted 1358
11 SASI_Hs01_00032660 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042192 predicted 1196
2 SASI_Rn01_00042193 predicted 834
3 SASI_Rn01_00042194 predicted 625
4 SASI_Rn01_00042195 predicted 598
5 SASI_Rn01_00042196 predicted 498
6 SASI_Rn01_00042197 predicted 686
7 SASI_Rn01_00042198 predicted 734
8 SASI_Rn01_00042199 predicted 1884
9 SASI_Rn01_00042200 predicted 1679
10 SASI_Rn01_00042201 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185612 predicted 1020
2 SASI_Mm02_00317914 predicted 680
3 SASI_Mm01_00185613 predicted 717
4 SASI_Mm01_00185614 predicted 964
5 SASI_Mm01_00185615 predicted 852
6 SASI_Mm01_00185616 predicted 517
7 SASI_Mm01_00185617 predicted 1060
8 SASI_Mm01_00185618 predicted 484
9 SASI_Mm01_00185619 predicted 943
10 SASI_Mm01_00185620 predicted 2024
11 SASI_Mm01_00185621 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152061 predicted 1022
2 SASI_Mm02_00352245 predicted 679
3 SASI_Mm01_00152062 predicted 723
4 SASI_Mm01_00152063 predicted 956
5 SASI_Mm01_00152064 predicted 854
6 SASI_Mm01_00152065 predicted 520
7 SASI_Mm01_00152066 predicted 1058
8 SASI_Mm01_00152067 predicted 493
9 SASI_Mm01_00152068 predicted 946
10 SASI_Mm01_00152069 predicted 2079
11 SASI_Mm01_00152070 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207707
ESR2 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor 2 (ER beta)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1121s1c1
Sequence:CCGGGCATTGCCTGAACAAAGCCAACTCGAGTTGGCTTTGTTCAGGCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1574s1c1
Sequence:CCGGGATTCTGGAAATCTTTGACATCTCGAGATGTCAAAGATTTCCAGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-963s1c1
Sequence:CCGGGCCACGAATCAGTGTACCATACTCGAGTATGGTACACTGATTCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-537s1c1
Sequence:CCGGGCCATGACATTCTACAGTCCTCTCGAGAGGACTGTAGAATGTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2520s21c1
Sequence:CCGGGAGGACTCATGACGTGTAATGCTCGAGCATTACACGTCATGAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207707.1-1610s21c1
Sequence:CCGGGGCACGGTTCCGTGAGTTAAACTCGAGTTTAACTCACGGAACCGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2404s21c1
Sequence:CCGGAGAACGGTGTGGTCATCAAATCTCGAGATTTGATGACCACACCGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207707
ESR2 MISSION shRNA shRNA Plasmid DNA
estrogen receptor 2 (ER beta)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1121s1c1
Sequence:CCGGGCATTGCCTGAACAAAGCCAACTCGAGTTGGCTTTGTTCAGGCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1574s1c1
Sequence:CCGGGATTCTGGAAATCTTTGACATCTCGAGATGTCAAAGATTTCCAGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-963s1c1
Sequence:CCGGGCCACGAATCAGTGTACCATACTCGAGTATGGTACACTGATTCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-537s1c1
Sequence:CCGGGCCATGACATTCTACAGTCCTCTCGAGAGGACTGTAGAATGTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2520s21c1
Sequence:CCGGGAGGACTCATGACGTGTAATGCTCGAGCATTACACGTCATGAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207707.1-1610s21c1
Sequence:CCGGGGCACGGTTCCGTGAGTTAAACTCGAGTTTAACTCACGGAACCGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2404s21c1
Sequence:CCGGAGAACGGTGTGGTCATCAAATCTCGAGATTTGATGACCACACCGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207707
ESR2 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor 2 (ER beta)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1121s1c1
Sequence:CCGGGCATTGCCTGAACAAAGCCAACTCGAGTTGGCTTTGTTCAGGCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-1574s1c1
Sequence:CCGGGATTCTGGAAATCTTTGACATCTCGAGATGTCAAAGATTTCCAGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-963s1c1
Sequence:CCGGGCCACGAATCAGTGTACCATACTCGAGTATGGTACACTGATTCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207707.1-537s1c1
Sequence:CCGGGCCATGACATTCTACAGTCCTCTCGAGAGGACTGTAGAATGTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2520s21c1
Sequence:CCGGGAGGACTCATGACGTGTAATGCTCGAGCATTACACGTCATGAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207707.1-1610s21c1
Sequence:CCGGGGCACGGTTCCGTGAGTTAAACTCGAGTTTAACTCACGGAACCGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207707.1-2404s21c1
Sequence:CCGGAGAACGGTGTGGTCATCAAATCTCGAGATTTGATGACCACACCGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001437
ESR2 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor 2 (ER beta)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1820s1c1
Sequence:CCGGGCGAGTAACAAGGGCATGGAACTCGAGTTCCATGCCCTTGTTACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-445s1c1
Sequence:CCGGCCTTAATTCTCCTTCCTCCTACTCGAGTAGGAGGAAGGAGAATTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1721s1c1
Sequence:CCGGGATGCTTTGGTTTGGGTGATTCTCGAGAATCACCCAAACCAAAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-674s1c1
Sequence:CCGGCTTTCTCCTTTAGTGGTCCATCTCGAGATGGACCACTAAAGGAGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1619s21c1
Sequence:CCGGCTTCAAGGTTTCGAGAGTTAACTCGAGTTAACTCTCGAAACCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1467s21c1
Sequence:CCGGCTGTTGGATGGAGGTGTTAATCTCGAGATTAACACCTCCATCCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-925s21c1
Sequence:CCGGAGCGATTACGCATCGGGATATCTCGAGATATCCCGATGCGTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-734s21c1
Sequence:CCGGTAGTGGTCCATCGCCAGTTATCTCGAGATAACTGGCGATGGACCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-576s21c1
Sequence:CCGGTGTAGACAGCCACCATGAATACTCGAGTATTCATGGTGGCTGTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001437
ESR2 MISSION shRNA shRNA Plasmid DNA
estrogen receptor 2 (ER beta)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1820s1c1
Sequence:CCGGGCGAGTAACAAGGGCATGGAACTCGAGTTCCATGCCCTTGTTACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-445s1c1
Sequence:CCGGCCTTAATTCTCCTTCCTCCTACTCGAGTAGGAGGAAGGAGAATTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1721s1c1
Sequence:CCGGGATGCTTTGGTTTGGGTGATTCTCGAGAATCACCCAAACCAAAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-674s1c1
Sequence:CCGGCTTTCTCCTTTAGTGGTCCATCTCGAGATGGACCACTAAAGGAGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1619s21c1
Sequence:CCGGCTTCAAGGTTTCGAGAGTTAACTCGAGTTAACTCTCGAAACCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1467s21c1
Sequence:CCGGCTGTTGGATGGAGGTGTTAATCTCGAGATTAACACCTCCATCCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-925s21c1
Sequence:CCGGAGCGATTACGCATCGGGATATCTCGAGATATCCCGATGCGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-734s21c1
Sequence:CCGGTAGTGGTCCATCGCCAGTTATCTCGAGATAACTGGCGATGGACCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-576s21c1
Sequence:CCGGTGTAGACAGCCACCATGAATACTCGAGTATTCATGGTGGCTGTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001437
ESR2 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor 2 (ER beta)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1820s1c1
Sequence:CCGGGCGAGTAACAAGGGCATGGAACTCGAGTTCCATGCCCTTGTTACTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-445s1c1
Sequence:CCGGCCTTAATTCTCCTTCCTCCTACTCGAGTAGGAGGAAGGAGAATTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-1721s1c1
Sequence:CCGGGATGCTTTGGTTTGGGTGATTCTCGAGAATCACCCAAACCAAAGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001437.x-674s1c1
Sequence:CCGGCTTTCTCCTTTAGTGGTCCATCTCGAGATGGACCACTAAAGGAGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1619s21c1
Sequence:CCGGCTTCAAGGTTTCGAGAGTTAACTCGAGTTAACTCTCGAAACCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-1467s21c1
Sequence:CCGGCTGTTGGATGGAGGTGTTAATCTCGAGATTAACACCTCCATCCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-925s21c1
Sequence:CCGGAGCGATTACGCATCGGGATATCTCGAGATATCCCGATGCGTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-734s21c1
Sequence:CCGGTAGTGGTCCATCGCCAGTTATCTCGAGATAACTGGCGATGGACCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001437.2-576s21c1
Sequence:CCGGTGTAGACAGCCACCATGAATACTCGAGTATTCATGGTGGCTGTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)