EMAIL THIS PAGE TO A FRIEND

ESRP1

epithelial splicing regulatory protein 1

228 Gene Product Result for
Synonyms: RBM35A RMB35A
Gene ID:
Human(54845) Summary: ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]
Mouse(207920) epithelial splicing regulatory protein 1
Rat(500409) epithelial splicing regulatory protein 1
Zebrafish(560190) epithelial splicing regulatory protein 1
dog(487054) epithelial splicing regulatory protein 1
Horse(100055214) epithelial splicing regulatory protein 1
cow(538640) epithelial splicing regulatory protein 1
domestic cat(101084770) epithelial splicing regulatory protein 1
chicken(420228) epithelial splicing regulatory protein 1
sheep(101109714) epithelial splicing regulatory protein 1
domestic guinea pig(100713164) epithelial splicing regulatory protein 1
naked mole-rat(101699706) epithelial splicing regulatory protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034915 Rosetta Predictions human pricing
NM_001122825 Rosetta Predictions human pricing
NM_001122826 Rosetta Predictions human pricing
NM_001122827 Rosetta Predictions human pricing
NM_017697 Rosetta Predictions human pricing
NM_001127564 Rosetta Predictions rat pricing
NM_194055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308155 predicted 1190
2 SASI_Hs01_00062865 predicted 434
3 SASI_Hs01_00062866 predicted 867
4 SASI_Hs01_00062867 predicted 691
5 SASI_Hs01_00062868 predicted 899
6 SASI_Hs01_00062869 predicted 854
7 SASI_Hs01_00062870 predicted 821
8 SASI_Hs02_00308156 predicted 1058
9 SASI_Hs01_00062872 predicted 822
10 SASI_Hs01_00062873 predicted 555
11 SASI_Hs01_00062871 predicted 845
12 SASI_Hs01_00062874 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327387 predicted 1198
2 SASI_Hs02_00327388 predicted 438
3 SASI_Hs02_00327389 predicted 872
4 SASI_Hs02_00327390 predicted 687
5 SASI_Hs02_00327391 predicted 893
6 SASI_Hs02_00327392 predicted 850
7 SASI_Hs02_00327393 predicted 827
8 SASI_Hs02_00327394 predicted 1058
9 SASI_Hs02_00327395 predicted 827
10 SASI_Hs02_00327396 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327397 predicted 1190
2 SASI_Hs02_00327398 predicted 433
3 SASI_Hs02_00327399 predicted 870
4 SASI_Hs02_00327400 predicted 682
5 SASI_Hs02_00327401 predicted 892
6 SASI_Hs02_00327402 predicted 855
7 SASI_Hs02_00327403 predicted 823
8 SASI_Hs02_00327404 predicted 1054
9 SASI_Hs02_00327405 predicted 825
10 SASI_Hs02_00327406 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327407 predicted 1198
2 SASI_Hs02_00327408 predicted 434
3 SASI_Hs02_00327409 predicted 865
4 SASI_Hs02_00327410 predicted 690
5 SASI_Hs02_00327411 predicted 900
6 SASI_Hs02_00327412 predicted 855
7 SASI_Hs02_00327413 predicted 825
8 SASI_Hs02_00327414 predicted 1057
9 SASI_Hs02_00327415 predicted 827
10 SASI_Hs02_00327416 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350450 predicted 1197
2 SASI_Hs01_00187077 predicted 432
3 SASI_Hs01_00187078 predicted 872
4 SASI_Hs01_00187079 predicted 684
5 SASI_Hs01_00187080 predicted 895
6 SASI_Hs01_00187081 predicted 852
7 SASI_Hs01_00187082 predicted 822
8 SASI_Hs02_00350451 predicted 1051
9 SASI_Hs01_00187084 predicted 823
10 SASI_Hs01_00187085 predicted 563
11 SASI_Hs01_00187083 predicted 835
12 SASI_Hs01_00187086 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254393 predicted 2181
2 SASI_Rn02_00254394 predicted 990
3 SASI_Rn02_00254395 predicted 2187
4 SASI_Rn02_00254396 predicted 1140
5 SASI_Rn02_00254397 predicted 1813
6 SASI_Rn02_00254398 predicted 284
7 SASI_Rn02_00254399 predicted 984
8 SASI_Rn02_00254400 predicted 2316
9 SASI_Rn02_00254401 predicted 1200
10 SASI_Rn02_00254402 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350569 predicted 823
2 SASI_Mm01_00196906 predicted 1111
3 SASI_Mm02_00350570 predicted 955
4 SASI_Mm02_00350571 predicted 2270
5 SASI_Mm02_00350572 predicted 2402
6 SASI_Mm01_00196907 predicted 1279
7 SASI_Mm01_00196909 predicted 1068
8 SASI_Mm02_00350573 predicted 723
9 SASI_Mm02_00350574 predicted 2272
10 SASI_Mm01_00196911 predicted 1844
11 SASI_Mm01_00196905 predicted 663
12 SASI_Mm01_00196908 predicted 1551
13 SASI_Mm01_00196910 predicted 957
14 SASI_Mm01_00196912 predicted 261
15 SASI_Mm01_00196913 predicted 372
16 SASI_Mm01_00196914 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017697
ESRP1 MISSION shRNA Bacterial Glycerol Stock
epithelial splicing regulatory protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-691s21c1
Sequence:CCGGAGTAGTTCAGTCTCTCGATATCTCGAGATATCGAGAGACTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017697.3-3335s21c1
Sequence:CCGGTAGCTGTGTTTATGCTATAAACTCGAGTTTATAGCATAAACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-1221s21c1
Sequence:CCGGTGGACAGCATTGCCCTATTACCTCGAGGTAATAGGGCAATGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-428s21c1
Sequence:CCGGACCAAGCCCTCCGACAGTTTACTCGAGTAAACTGTCGGAGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017697.3-2482s1c1
Sequence:CCGGCTGATTGCAAATAGGCATTTACTCGAGTAAATGCCTATTTGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-324s21c1
Sequence:CCGGGTTGCACGAAGTGCTAGTTAGCTCGAGCTAACTAGCACTTCGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-218s1c1
Sequence:CCGGCTTGCAGCAAGATGGAACTTACTCGAGTAAGTTCCATCTTGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-744s1c1
Sequence:CCGGGCATAAAGACTTGTTGGGTAACTCGAGTTACCCAACAAGTCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-453s1c1
Sequence:CCGGCCGGTATATTGAGGTTTACAACTCGAGTTGTAAACCTCAATATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017697
ESRP1 MISSION shRNA shRNA Plasmid DNA
epithelial splicing regulatory protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-691s21c1
Sequence:CCGGAGTAGTTCAGTCTCTCGATATCTCGAGATATCGAGAGACTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017697.3-3335s21c1
Sequence:CCGGTAGCTGTGTTTATGCTATAAACTCGAGTTTATAGCATAAACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-1221s21c1
Sequence:CCGGTGGACAGCATTGCCCTATTACCTCGAGGTAATAGGGCAATGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-428s21c1
Sequence:CCGGACCAAGCCCTCCGACAGTTTACTCGAGTAAACTGTCGGAGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017697.3-2482s1c1
Sequence:CCGGCTGATTGCAAATAGGCATTTACTCGAGTAAATGCCTATTTGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-324s21c1
Sequence:CCGGGTTGCACGAAGTGCTAGTTAGCTCGAGCTAACTAGCACTTCGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-218s1c1
Sequence:CCGGCTTGCAGCAAGATGGAACTTACTCGAGTAAGTTCCATCTTGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-744s1c1
Sequence:CCGGGCATAAAGACTTGTTGGGTAACTCGAGTTACCCAACAAGTCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-453s1c1
Sequence:CCGGCCGGTATATTGAGGTTTACAACTCGAGTTGTAAACCTCAATATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017697
ESRP1 MISSION shRNA Lentiviral Transduction Particles
epithelial splicing regulatory protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-691s21c1
Sequence:CCGGAGTAGTTCAGTCTCTCGATATCTCGAGATATCGAGAGACTGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017697.3-3335s21c1
Sequence:CCGGTAGCTGTGTTTATGCTATAAACTCGAGTTTATAGCATAAACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-1221s21c1
Sequence:CCGGTGGACAGCATTGCCCTATTACCTCGAGGTAATAGGGCAATGCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-428s21c1
Sequence:CCGGACCAAGCCCTCCGACAGTTTACTCGAGTAAACTGTCGGAGGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017697.3-2482s1c1
Sequence:CCGGCTGATTGCAAATAGGCATTTACTCGAGTAAATGCCTATTTGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017697.3-324s21c1
Sequence:CCGGGTTGCACGAAGTGCTAGTTAGCTCGAGCTAACTAGCACTTCGTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-218s1c1
Sequence:CCGGCTTGCAGCAAGATGGAACTTACTCGAGTAAGTTCCATCTTGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-744s1c1
Sequence:CCGGGCATAAAGACTTGTTGGGTAACTCGAGTTACCCAACAAGTCTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017697.1-453s1c1
Sequence:CCGGCCGGTATATTGAGGTTTACAACTCGAGTTGTAAACCTCAATATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194055
ESRP1 MISSION shRNA Bacterial Glycerol Stock
epithelial splicing regulatory protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194055.1-2180s1c1
Sequence:CCGGCCACCTGTAAATAAGAAGAAACTCGAGTTTCTTCTTATTTACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-929s1c1
Sequence:CCGGCCTCCCATTATCCCTGTACTACTCGAGTAGTACAGGGATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-1013s1c1
Sequence:CCGGGCTGCCACAATAGAAGACATTCTCGAGAATGTCTTCTATTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-526s1c1
Sequence:CCGGCCGGTACATTGAGGTTTACAACTCGAGTTGTAAACCTCAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-527s1c1
Sequence:CCGGCGGTACATTGAGGTTTACAAACTCGAGTTTGTAAACCTCAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194055
ESRP1 MISSION shRNA shRNA Plasmid DNA
epithelial splicing regulatory protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194055.1-2180s1c1
Sequence:CCGGCCACCTGTAAATAAGAAGAAACTCGAGTTTCTTCTTATTTACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-929s1c1
Sequence:CCGGCCTCCCATTATCCCTGTACTACTCGAGTAGTACAGGGATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-1013s1c1
Sequence:CCGGGCTGCCACAATAGAAGACATTCTCGAGAATGTCTTCTATTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-526s1c1
Sequence:CCGGCCGGTACATTGAGGTTTACAACTCGAGTTGTAAACCTCAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-527s1c1
Sequence:CCGGCGGTACATTGAGGTTTACAAACTCGAGTTTGTAAACCTCAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194055
ESRP1 MISSION shRNA Lentiviral Transduction Particles
epithelial splicing regulatory protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194055.1-2180s1c1
Sequence:CCGGCCACCTGTAAATAAGAAGAAACTCGAGTTTCTTCTTATTTACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-929s1c1
Sequence:CCGGCCTCCCATTATCCCTGTACTACTCGAGTAGTACAGGGATAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-1013s1c1
Sequence:CCGGGCTGCCACAATAGAAGACATTCTCGAGAATGTCTTCTATTGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-526s1c1
Sequence:CCGGCCGGTACATTGAGGTTTACAACTCGAGTTGTAAACCTCAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194055.1-527s1c1
Sequence:CCGGCGGTACATTGAGGTTTACAAACTCGAGTTTGTAAACCTCAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks