EMAIL THIS PAGE TO A FRIEND

ESRP2

epithelial splicing regulatory protein 2

86 Gene Product Result for
Synonyms: RBM35B
UniProtKB ID: Q9H6T0, Q8N6H8, Q8WZ15, Q9H6I4
Gene ID:
Human(80004) Summary: ESPR2 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]
Mouse(77411) epithelial splicing regulatory protein 2
Rat(307810) epithelial splicing regulatory protein 2
naked mole-rat(101696948) epithelial splicing regulatory protein 2
domestic guinea pig(100728151) epithelial splicing regulatory protein 2
sheep(101118043) epithelial splicing regulatory protein 2
Zebrafish(572992) epithelial splicing regulatory protein 2
chicken(415710) epithelial splicing regulatory protein 2
cow(510878) epithelial splicing regulatory protein 2
domestic cat(101092569) epithelial splicing regulatory protein 2
dog(489745) epithelial splicing regulatory protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701596 Anti-ESRP2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA048597 Anti-ESRP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106589 Anti-ESRP2 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human, rabbit
ELISA, western blot pricing
SAB3500719 Anti-ESRP2 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA040751 Anti-ESRP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA048618 Anti-ESRP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1401836 Anti-RBM35B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV37559 Anti-RBM35B antibody produced in rabbit IgG fraction of antiserum human, rat, canine, rabbit, mouse, guinea pig
western blot pricing
SAB2101958 Anti-RBM35B antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, rat, guinea pig
western blot pricing
SAB3701431 Monoclonal Anti-Esrp-1/2 antibody produced in mouse clone 23A7.C9, purified immunoglobulin mouse
ELISA, western blot pricing
SAB3701432 Monoclonal Anti-Esrp-2 antibody produced in mouse clone 22C5.H7.A6, purified immunoglobulin mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120821 MISSION® esiRNA esiRNA human RBM35B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024939 Rosetta Predictions human pricing
NM_001107423 Rosetta Predictions rat pricing
NM_176838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158206 predicted 1194
2 SASI_Hs01_00158207 predicted 1186
3 SASI_Hs01_00158208 predicted 1126
4 SASI_Hs01_00158210 predicted 638
5 SASI_Hs02_00357574 predicted 2348
6 SASI_Hs01_00158211 predicted 2367
7 SASI_Hs01_00158212 predicted 1125
8 SASI_Hs01_00158213 predicted 2201
9 SASI_Hs01_00158214 predicted 2256
10 SASI_Hs01_00158215 predicted 1824
11 SASI_Hs01_00158209 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228675 predicted 1170
2 SASI_Rn02_00228676 predicted 1087
3 SASI_Rn02_00228677 predicted 1843
4 SASI_Rn02_00228678 predicted 425
5 SASI_Rn02_00228679 predicted 2359
6 SASI_Rn02_00228680 predicted 1661
7 SASI_Rn02_00228681 predicted 1020
8 SASI_Rn02_00228682 predicted 377
9 SASI_Rn02_00228683 predicted 840
10 SASI_Rn02_00228684 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080499 predicted 1140
2 SASI_Mm01_00080500 predicted 1815
3 SASI_Mm01_00080501 predicted 1631
4 SASI_Mm01_00080502 predicted 2432
5 SASI_Mm01_00080503 predicted 1280
6 SASI_Mm01_00080504 predicted 514
7 SASI_Mm01_00080505 predicted 990
8 SASI_Mm01_00080506 predicted 2337
9 SASI_Mm01_00080507 predicted 810
10 SASI_Mm01_00080508 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024939
ESRP2 MISSION shRNA Bacterial Glycerol Stock
epithelial splicing regulatory protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-2060s1c1
Sequence:CCGGCCTGAACTACACAGCCTACTACTCGAGTAGTAGGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-1619s1c1
Sequence:CCGGCATTGAAGACATCCTGAGCTTCTCGAGAAGCTCAGGATGTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-644s1c1
Sequence:CCGGCGACATGTTCTTCTCCTTCTACTCGAGTAGAAGGAGAAGAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-2763s1c1
Sequence:CCGGCCTCTGAGTAAAGATCCCAATCTCGAGATTGGGATCTTTACTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-3541s1c1
Sequence:CCGGGCCTTAAAGATCCATTCTGAACTCGAGTTCAGAATGGATCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024939
ESRP2 MISSION shRNA shRNA Plasmid DNA
epithelial splicing regulatory protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-2060s1c1
Sequence:CCGGCCTGAACTACACAGCCTACTACTCGAGTAGTAGGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-1619s1c1
Sequence:CCGGCATTGAAGACATCCTGAGCTTCTCGAGAAGCTCAGGATGTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-644s1c1
Sequence:CCGGCGACATGTTCTTCTCCTTCTACTCGAGTAGAAGGAGAAGAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-2763s1c1
Sequence:CCGGCCTCTGAGTAAAGATCCCAATCTCGAGATTGGGATCTTTACTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-3541s1c1
Sequence:CCGGGCCTTAAAGATCCATTCTGAACTCGAGTTCAGAATGGATCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024939
ESRP2 MISSION shRNA Lentiviral Transduction Particles
epithelial splicing regulatory protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-2060s1c1
Sequence:CCGGCCTGAACTACACAGCCTACTACTCGAGTAGTAGGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-1619s1c1
Sequence:CCGGCATTGAAGACATCCTGAGCTTCTCGAGAAGCTCAGGATGTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024939.2-644s1c1
Sequence:CCGGCGACATGTTCTTCTCCTTCTACTCGAGTAGAAGGAGAAGAACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-2763s1c1
Sequence:CCGGCCTCTGAGTAAAGATCCCAATCTCGAGATTGGGATCTTTACTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024939.2-3541s1c1
Sequence:CCGGGCCTTAAAGATCCATTCTGAACTCGAGTTCAGAATGGATCTTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176838
ESRP2 MISSION shRNA Bacterial Glycerol Stock
epithelial splicing regulatory protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-356s1c1
Sequence:CCGGCCGACTTAATCCTCCTAGTTTCTCGAGAAACTAGGAGGATTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1979s1c1
Sequence:CCGGCGACAGCACTATATCCCTCTTCTCGAGAAGAGGGATATAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1149s1c1
Sequence:CCGGCCGCTATATTGAGGTATATAACTCGAGTTATATACCTCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-829s1c1
Sequence:CCGGGCTGTTATTCTCCACCTACTTCTCGAGAAGTAGGTGGAGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176838.2-2443s1c1
Sequence:CCGGGCTTCTTTATGGCTCGTCAAACTCGAGTTTGACGAGCCATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1973s21c1
Sequence:CCGGCAGAGACGACAGCACTATATCCTCGAGGATATAGTGCTGTCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-345s21c1
Sequence:CCGGCTCGGACGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-2035s21c1
Sequence:CCGGGCCACTCCTCTTGCCTATTACCTCGAGGTAATAGGCAAGAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176838.2-2444s21c1
Sequence:CCGGCTTCTTTATGGCTCGTCAAAGCTCGAGCTTTGACGAGCCATAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1138s21c1
Sequence:CCGGCACATGGGTGTCCGCTATATTCTCGAGAATATAGCGGACACCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176838
ESRP2 MISSION shRNA shRNA Plasmid DNA
epithelial splicing regulatory protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-356s1c1
Sequence:CCGGCCGACTTAATCCTCCTAGTTTCTCGAGAAACTAGGAGGATTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1979s1c1
Sequence:CCGGCGACAGCACTATATCCCTCTTCTCGAGAAGAGGGATATAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1149s1c1
Sequence:CCGGCCGCTATATTGAGGTATATAACTCGAGTTATATACCTCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-829s1c1
Sequence:CCGGGCTGTTATTCTCCACCTACTTCTCGAGAAGTAGGTGGAGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176838.2-2443s1c1
Sequence:CCGGGCTTCTTTATGGCTCGTCAAACTCGAGTTTGACGAGCCATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1973s21c1
Sequence:CCGGCAGAGACGACAGCACTATATCCTCGAGGATATAGTGCTGTCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-345s21c1
Sequence:CCGGCTCGGACGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-2035s21c1
Sequence:CCGGGCCACTCCTCTTGCCTATTACCTCGAGGTAATAGGCAAGAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176838.2-2444s21c1
Sequence:CCGGCTTCTTTATGGCTCGTCAAAGCTCGAGCTTTGACGAGCCATAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1138s21c1
Sequence:CCGGCACATGGGTGTCCGCTATATTCTCGAGAATATAGCGGACACCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176838
ESRP2 MISSION shRNA Lentiviral Transduction Particles
epithelial splicing regulatory protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-356s1c1
Sequence:CCGGCCGACTTAATCCTCCTAGTTTCTCGAGAAACTAGGAGGATTAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1979s1c1
Sequence:CCGGCGACAGCACTATATCCCTCTTCTCGAGAAGAGGGATATAGTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-1149s1c1
Sequence:CCGGCCGCTATATTGAGGTATATAACTCGAGTTATATACCTCAATATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176838.2-829s1c1
Sequence:CCGGGCTGTTATTCTCCACCTACTTCTCGAGAAGTAGGTGGAGAATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176838.2-2443s1c1
Sequence:CCGGGCTTCTTTATGGCTCGTCAAACTCGAGTTTGACGAGCCATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1973s21c1
Sequence:CCGGCAGAGACGACAGCACTATATCCTCGAGGATATAGTGCTGTCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-345s21c1
Sequence:CCGGCTCGGACGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-2035s21c1
Sequence:CCGGGCCACTCCTCTTGCCTATTACCTCGAGGTAATAGGCAAGAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176838.2-2444s21c1
Sequence:CCGGCTTCTTTATGGCTCGTCAAAGCTCGAGCTTTGACGAGCCATAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176838.2-1138s21c1
Sequence:CCGGCACATGGGTGTCCGCTATATTCTCGAGAATATAGCGGACACCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks