EMAIL THIS PAGE TO A FRIEND

ESRRA

estrogen-related receptor alpha

166 Gene Product Result for
Synonyms: ERR1 ERRa ERRalpha ESRL1 NR3B1
UniProtKB ID: P11474, Q14514
Gene ID:
Human(2101) Summary: The protein encoded by this gene is a nuclear receptor that is closely related to the estrogen receptor. This protein acts as a site-specific transcription regulator and has been also shown to interact with estrogen and the transcripton factor TFIIB by direct protein-protein contact. The binding and regulatory activities of this protein have been demonstrated in the regulation of a variety of genes including lactoferrin, osteopontin, medium-chain acyl coenzyme A dehydrogenase (MCAD) and thyroid hormone receptor genes. A processed pseudogene of ESRRA is located on chromosome 13q12.1. [provided by RefSeq, Jul 2008]
Mouse(26379) estrogen related receptor, alpha
Rat(293701) estrogen related receptor, alpha
Zebrafish(405891) estrogen-related receptor alpha
cow(507834) estrogen-related receptor alpha
domestic cat(101099657) estrogen-related receptor alpha
dog(403169) estrogen-related receptor alpha
sheep(101116615) estrogen-related receptor alpha
domestic guinea pig(100734430) estrogen-related receptor alpha
naked mole-rat(101725053) estrogen-related receptor alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004451 Rosetta Predictions human pricing
NM_001008511 Rosetta Predictions rat pricing
XM_579189 Rosetta Predictions rat pricing
NM_007953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193458 predicted 768
2 SASI_Hs01_00193459 predicted 1398
3 SASI_Hs01_00193460 predicted 438
4 SASI_Hs01_00193461 predicted 869
5 SASI_Hs01_00193462 predicted 1183
6 SASI_Hs01_00193464 predicted 1212
7 SASI_Hs01_00193465 predicted 1178
8 SASI_Hs02_00337632 predicted 1034
9 SASI_Hs01_00193466 predicted 1429
10 SASI_Hs01_00193467 predicted 448
11 SASI_Hs01_00193463 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199183 predicted 1825
2 SASI_Rn02_00199184 predicted 1120
3 SASI_Rn02_00199185 predicted 1120
4 SASI_Rn02_00199186 predicted 815
5 SASI_Rn01_00074834 predicted 825
6 SASI_Rn01_00074835 predicted 1129
7 SASI_Rn02_00199187 predicted 1284
8 SASI_Rn02_00199188 predicted 1571
9 SASI_Rn02_00199189 predicted 300
10 SASI_Rn02_00199190 predicted 1084
11 SASI_Rn01_00074831 predicted 738
12 SASI_Rn01_00074832 predicted 696
13 SASI_Rn01_00074833 predicted 761
14 SASI_Rn01_00074836 predicted 604
15 SASI_Rn01_00074837 predicted 631
16 SASI_Rn01_00074838 predicted 364
17 SASI_Rn01_00074839 predicted 696
18 SASI_Rn01_00074840 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127831 predicted 224
2 SASI_Rn01_00127832 predicted 212
3 SASI_Rn01_00127833 predicted 364
4 SASI_Rn01_00127834 predicted 976
5 SASI_Rn01_00127835 predicted 215
6 SASI_Rn01_00127836 predicted 986
7 SASI_Rn01_00127837 predicted 1010
8 SASI_Rn01_00127838 predicted 230
9 SASI_Rn01_00127839 predicted 356
10 SASI_Rn01_00127840 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312820 predicted 224
2 SASI_Mm02_00312821 predicted 977
3 SASI_Mm01_00039302 predicted 259
4 SASI_Mm02_00312822 predicted 784
5 SASI_Mm01_00039304 predicted 1148
6 SASI_Mm02_00312823 predicted 213
7 SASI_Mm01_00039305 predicted 1211
8 SASI_Mm01_00039306 predicted 1194
9 SASI_Mm02_00312824 predicted 1656
10 SASI_Mm01_00039307 predicted 1903
11 SASI_Mm01_00039298 predicted 1386
12 SASI_Mm01_00039299 predicted 762
13 SASI_Mm01_00039300 predicted 1477
14 SASI_Mm01_00039301 predicted 1173
15 SASI_Mm01_00039303 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004451
VALIDATED
ESRRA MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-757s21c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004451.3-1039s21c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1145s21c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-865s21c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1881s21c1
Sequence:CCGGTCGCTCCTCCTCTCATCATTTCTCGAGAAATGATGAGAGGAGGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1145s1c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004451.3-440s1c1
Sequence:CCGGGCTACCACTATGGTGTGGCATCTCGAGATGCCACACCATAGTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-865s1c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-757s1c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1039s1c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004451
VALIDATED
ESRRA MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-757s21c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004451.3-1039s21c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1145s21c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-865s21c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1881s21c1
Sequence:CCGGTCGCTCCTCCTCTCATCATTTCTCGAGAAATGATGAGAGGAGGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1145s1c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004451.3-440s1c1
Sequence:CCGGGCTACCACTATGGTGTGGCATCTCGAGATGCCACACCATAGTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-865s1c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-757s1c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1039s1c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004451
VALIDATED
ESRRA MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-757s21c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004451.3-1039s21c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1145s21c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-865s21c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004451.3-1881s21c1
Sequence:CCGGTCGCTCCTCCTCTCATCATTTCTCGAGAAATGATGAGAGGAGGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1145s1c1
Sequence:CCGGGAGAGGAGTATGTTCTACTAACTCGAGTTAGTAGAACATACTCCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004451.3-440s1c1
Sequence:CCGGGCTACCACTATGGTGTGGCATCTCGAGATGCCACACCATAGTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-865s1c1
Sequence:CCGGGACCTCTTTGACCGAGAGATTCTCGAGAATCTCTCGGTCAAAGAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-757s1c1
Sequence:CCGGGTGAATGCACTGGTGTCTCATCTCGAGATGAGACACCAGTGCATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004451.3-1039s1c1
Sequence:CCGGGAGGACTTAGTCCTGGATGAACTCGAGTTCATCCAGGACTAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007953
VALIDATED
ESRRA MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1918s21c1
Sequence:CCGGCCTCATCCGCATTGGGCATTACTCGAGTAATGCCCAATGCGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007953.2-791s21c1
Sequence:CCGGTCGCATCTGCTGGTGGTTGAACTCGAGTTCAACCACCAGCAGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-408s21c1
Sequence:CCGGTGCTCAGCTCTCTACCCAAACCTCGAGGTTTGGGTAGAGAGCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-250s21c1
Sequence:CCGGAGCCAGTCCTGACAGTCCAAACTCGAGTTTGGACTGTCAGGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1203s21c1
Sequence:CCGGATTCTGACTCTGTGCACATTGCTCGAGCAATGTGCACAGAGTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-923s1c1
Sequence:CCGGCTGTCTGACCAGATGTCAGTACTCGAGTACTGACATCTGGTCAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-1334s1c1
Sequence:CCGGGCAGGCAAAGTCCTGGCCCATCTCGAGATGGGCCAGGACTTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-222s1c1
Sequence:CCGGGCCCTGACAGTCCAAAGGGTTCTCGAGAACCCTTTGGACTGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007953.1-766s1c1
Sequence:CCGGGCTGGTTGTTGAACCTGAGAACTCGAGTTCTCAGGTTCAACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-2015s1c1
Sequence:CCGGGCAGAGCAATAACACTATATTCTCGAGAATATAGTGTTATTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007953
VALIDATED
ESRRA MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1918s21c1
Sequence:CCGGCCTCATCCGCATTGGGCATTACTCGAGTAATGCCCAATGCGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007953.2-791s21c1
Sequence:CCGGTCGCATCTGCTGGTGGTTGAACTCGAGTTCAACCACCAGCAGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-408s21c1
Sequence:CCGGTGCTCAGCTCTCTACCCAAACCTCGAGGTTTGGGTAGAGAGCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-250s21c1
Sequence:CCGGAGCCAGTCCTGACAGTCCAAACTCGAGTTTGGACTGTCAGGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1203s21c1
Sequence:CCGGATTCTGACTCTGTGCACATTGCTCGAGCAATGTGCACAGAGTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-923s1c1
Sequence:CCGGCTGTCTGACCAGATGTCAGTACTCGAGTACTGACATCTGGTCAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-1334s1c1
Sequence:CCGGGCAGGCAAAGTCCTGGCCCATCTCGAGATGGGCCAGGACTTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-222s1c1
Sequence:CCGGGCCCTGACAGTCCAAAGGGTTCTCGAGAACCCTTTGGACTGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007953.1-766s1c1
Sequence:CCGGGCTGGTTGTTGAACCTGAGAACTCGAGTTCTCAGGTTCAACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-2015s1c1
Sequence:CCGGGCAGAGCAATAACACTATATTCTCGAGAATATAGTGTTATTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007953
VALIDATED
ESRRA MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1918s21c1
Sequence:CCGGCCTCATCCGCATTGGGCATTACTCGAGTAATGCCCAATGCGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007953.2-791s21c1
Sequence:CCGGTCGCATCTGCTGGTGGTTGAACTCGAGTTCAACCACCAGCAGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-408s21c1
Sequence:CCGGTGCTCAGCTCTCTACCCAAACCTCGAGGTTTGGGTAGAGAGCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-250s21c1
Sequence:CCGGAGCCAGTCCTGACAGTCCAAACTCGAGTTTGGACTGTCAGGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007953.2-1203s21c1
Sequence:CCGGATTCTGACTCTGTGCACATTGCTCGAGCAATGTGCACAGAGTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-923s1c1
Sequence:CCGGCTGTCTGACCAGATGTCAGTACTCGAGTACTGACATCTGGTCAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-1334s1c1
Sequence:CCGGGCAGGCAAAGTCCTGGCCCATCTCGAGATGGGCCAGGACTTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-222s1c1
Sequence:CCGGGCCCTGACAGTCCAAAGGGTTCTCGAGAACCCTTTGGACTGTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007953.1-766s1c1
Sequence:CCGGGCTGGTTGTTGAACCTGAGAACTCGAGTTCTCAGGTTCAACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007953.1-2015s1c1
Sequence:CCGGGCAGAGCAATAACACTATATTCTCGAGAATATAGTGTTATTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks