EMAIL THIS PAGE TO A FRIEND

ESRRB

estrogen-related receptor beta

70 Gene Product Result for
Synonyms: DFNB35 ERR2 ERRb ESRL2 NR3B2
UniProtKB ID: O95718, A2VDJ2, B6ZGU4, Q5F0P7, Q5F0P8, Q9HCB4
Gene ID:
Human(2103) Summary: This gene encodes a protein with similarity to the estrogen receptor. Its function is unknown; however, a similar protein in mouse plays an essential role in placental development. [provided by RefSeq, Jul 2008]
Mouse(26380) estrogen related receptor, beta
Rat(299210) estrogen-related receptor beta
Zebrafish(407693) estrogen-related receptor beta
chicken(771938) estrogen-related receptor beta
domestic cat(101099562) estrogen-related receptor beta
cow(528437) estrogen-related receptor beta
Horse(100058699) estrogen-related receptor beta
dog(490798) estrogen-related receptor beta
naked mole-rat(101711089) estrogen-related receptor beta
domestic guinea pig(100725854) estrogen-related receptor beta
sheep(101109022) estrogen-related receptor beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31654 Anti-ESRRB antibody produced in rabbit affinity isolated antibody horse, human, rat, bovine, mouse, guinea pig, canine, rabbit
western blot pricing
SAB2100715 Anti-ESRRB antibody produced in rabbit affinity isolated antibody bovine, rat, guinea pig, mouse, horse, human, rabbit, canine
western blot pricing
SAB3501007 Anti-ESRRB antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
E0156 Anti-Estrogen-Related Receptor β antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004452 Rosetta Predictions human pricing
NM_001008516 Rosetta Predictions rat pricing
NM_011934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180407 predicted 955
2 SASI_Hs02_00337633 predicted 1089
3 SASI_Hs01_00180409 predicted 1381
4 SASI_Hs01_00180410 predicted 1827
5 SASI_Hs01_00180411 predicted 715
6 SASI_Hs01_00180412 predicted 1556
7 SASI_Hs01_00180413 predicted 1400
8 SASI_Hs01_00180414 predicted 1106
9 SASI_Hs01_00180415 predicted 1377
10 SASI_Hs01_00180416 predicted 839
11 SASI_Hs01_00180408 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101133 predicted 1054
2 SASI_Rn01_00101134 predicted 764
3 SASI_Rn01_00101135 predicted 666
4 SASI_Rn01_00101136 predicted 625
5 SASI_Rn01_00101137 predicted 1048
6 SASI_Rn01_00101138 predicted 201
7 SASI_Rn01_00101139 predicted 732
8 SASI_Rn01_00101140 predicted 1044
9 SASI_Rn01_00101141 predicted 215
10 SASI_Rn01_00101142 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156043 predicted 794
2 SASI_Mm01_00156044 predicted 593
3 SASI_Mm01_00156045 predicted 1643
4 SASI_Mm01_00156046 predicted 1666
5 SASI_Mm01_00156047 predicted 821
6 SASI_Mm01_00156048 predicted 1483
7 SASI_Mm01_00156049 predicted 1173
8 SASI_Mm01_00156050 predicted 1360
9 SASI_Mm02_00321777 predicted 460
10 SASI_Mm01_00156051 predicted 644
11 SASI_Mm01_00156052 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011934
ESRRB MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-698s1c1
Sequence:CCGGCGCCATCAAATGCGAGTACATCTCGAGATGTACTCGCATTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011934.2-3708s1c1
Sequence:CCGGCCTCTCTATGATAGTGCGTATCTCGAGATACGCACTATCATAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-912s1c1
Sequence:CCGGCGATTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-1341s1c1
Sequence:CCGGGCCGAGGACTATATCATGGATCTCGAGATCCATGATATAGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011934.4-2022s21c1
Sequence:CCGGGGACCCAAGAGACATAGATTGCTCGAGCAATCTATGTCTCTTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-1386s21c1
Sequence:CCGGACTCAGATTCGATGTACATTGCTCGAGCAATGTACATCGAATCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-960s21c1
Sequence:CCGGTGACTAAGATCGTCTCGAATCCTCGAGGATTCGAGACGATCTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011934
ESRRB MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-698s1c1
Sequence:CCGGCGCCATCAAATGCGAGTACATCTCGAGATGTACTCGCATTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011934.2-3708s1c1
Sequence:CCGGCCTCTCTATGATAGTGCGTATCTCGAGATACGCACTATCATAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-912s1c1
Sequence:CCGGCGATTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-1341s1c1
Sequence:CCGGGCCGAGGACTATATCATGGATCTCGAGATCCATGATATAGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011934.4-2022s21c1
Sequence:CCGGGGACCCAAGAGACATAGATTGCTCGAGCAATCTATGTCTCTTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-1386s21c1
Sequence:CCGGACTCAGATTCGATGTACATTGCTCGAGCAATGTACATCGAATCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-960s21c1
Sequence:CCGGTGACTAAGATCGTCTCGAATCCTCGAGGATTCGAGACGATCTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011934
ESRRB MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-698s1c1
Sequence:CCGGCGCCATCAAATGCGAGTACATCTCGAGATGTACTCGCATTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011934.2-3708s1c1
Sequence:CCGGCCTCTCTATGATAGTGCGTATCTCGAGATACGCACTATCATAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-912s1c1
Sequence:CCGGCGATTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011934.2-1341s1c1
Sequence:CCGGGCCGAGGACTATATCATGGATCTCGAGATCCATGATATAGTCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011934.4-2022s21c1
Sequence:CCGGGGACCCAAGAGACATAGATTGCTCGAGCAATCTATGTCTCTTGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-1386s21c1
Sequence:CCGGACTCAGATTCGATGTACATTGCTCGAGCAATGTACATCGAATCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011934.4-960s21c1
Sequence:CCGGTGACTAAGATCGTCTCGAATCCTCGAGGATTCGAGACGATCTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004452
ESRRB MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1598s1c1
Sequence:CCGGGCACAAACTCTTCCTGGAGATCTCGAGATCTCCAGGAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1239s1c1
Sequence:CCGGGCTGAGGACTACATCATGGATCTCGAGATCCATGATGTAGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-917s1c1
Sequence:CCGGCCCATACCTGAGCTTACAAATCTCGAGATTTGTAAGCTCAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-810s1c1
Sequence:CCGGCGCTTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2242s21c1
Sequence:CCGGGGTGAAGTGAGGAGAGTTTAGCTCGAGCTAAACTCTCCTCACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-757s21c1
Sequence:CCGGGGACTATCCAAGGGAACATTGCTCGAGCAATGTTCCCTTGGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2278s21c1
Sequence:CCGGGTGGAACAGATCTCAAGTTTACTCGAGTAAACTTGAGATCTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-1594s21c1
Sequence:CCGGAGCACTTCTATAGCGTCAAACCTCGAGGTTTGACGCTATAGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004452
ESRRB MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1598s1c1
Sequence:CCGGGCACAAACTCTTCCTGGAGATCTCGAGATCTCCAGGAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1239s1c1
Sequence:CCGGGCTGAGGACTACATCATGGATCTCGAGATCCATGATGTAGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-917s1c1
Sequence:CCGGCCCATACCTGAGCTTACAAATCTCGAGATTTGTAAGCTCAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-810s1c1
Sequence:CCGGCGCTTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2242s21c1
Sequence:CCGGGGTGAAGTGAGGAGAGTTTAGCTCGAGCTAAACTCTCCTCACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-757s21c1
Sequence:CCGGGGACTATCCAAGGGAACATTGCTCGAGCAATGTTCCCTTGGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2278s21c1
Sequence:CCGGGTGGAACAGATCTCAAGTTTACTCGAGTAAACTTGAGATCTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-1594s21c1
Sequence:CCGGAGCACTTCTATAGCGTCAAACCTCGAGGTTTGACGCTATAGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004452
ESRRB MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1598s1c1
Sequence:CCGGGCACAAACTCTTCCTGGAGATCTCGAGATCTCCAGGAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-1239s1c1
Sequence:CCGGGCTGAGGACTACATCATGGATCTCGAGATCCATGATGTAGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-917s1c1
Sequence:CCGGCCCATACCTGAGCTTACAAATCTCGAGATTTGTAAGCTCAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004452.2-810s1c1
Sequence:CCGGCGCTTCATGAAATGCCTCAAACTCGAGTTTGAGGCATTTCATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2242s21c1
Sequence:CCGGGGTGAAGTGAGGAGAGTTTAGCTCGAGCTAAACTCTCCTCACTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-757s21c1
Sequence:CCGGGGACTATCCAAGGGAACATTGCTCGAGCAATGTTCCCTTGGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004452.3-2278s21c1
Sequence:CCGGGTGGAACAGATCTCAAGTTTACTCGAGTAAACTTGAGATCTGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004452.3-1594s21c1
Sequence:CCGGAGCACTTCTATAGCGTCAAACCTCGAGGTTTGACGCTATAGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks