EMAIL THIS PAGE TO A FRIEND

ESRRG

estrogen-related receptor gamma

276 Gene Product Result for
Synonyms: ERR3 ERRgamma NR3B3
Gene ID:
Human(2104) Summary: This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
Mouse(26381) estrogen-related receptor gamma
Rat(360896) estrogen-related receptor gamma
chicken(421357) estrogen-related receptor gamma
Horse(100050530) estrogen-related receptor gamma
cow(536732) estrogen-related receptor gamma
domestic cat(101091751) estrogen-related receptor gamma
dog(478961) estrogen-related receptor gamma
sheep(101102323) estrogen-related receptor gamma
domestic guinea pig(100719060) estrogen-related receptor gamma
naked mole-rat(101705764) estrogen-related receptor gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
218944 Diethylstilbestrol, mixture of cis and trans 97% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_206595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206595 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149921 MISSION® esiRNA esiRNA targeting mouse Esrrg mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001438 Rosetta Predictions human pricing
NM_206594 Rosetta Predictions human pricing
NM_206595 Rosetta Predictions human pricing
NM_203336 Rosetta Predictions rat pricing
NM_011935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241628 predicted 997
2 SASI_Hs01_00241629 predicted 1205
3 SASI_Hs01_00241630 predicted 560
4 SASI_Hs01_00241631 predicted 789
5 SASI_Hs01_00241632 predicted 689
6 SASI_Hs01_00241633 predicted 1095
7 SASI_Hs01_00241634 predicted 1267
8 SASI_Hs01_00241635 predicted 988
9 SASI_Hs01_00241636 predicted 1010
10 SASI_Hs01_00241637 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217203 predicted 1109
2 SASI_Hs01_00217204 predicted 1315
3 SASI_Hs01_00217205 predicted 668
4 SASI_Hs01_00217206 predicted 899
5 SASI_Hs01_00217207 predicted 805
6 SASI_Hs01_00217208 predicted 1210
7 SASI_Hs01_00217209 predicted 1388
8 SASI_Hs01_00217210 predicted 1112
9 SASI_Hs01_00217211 predicted 1127
10 SASI_Hs01_00217212 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042292 predicted 994
2 SASI_Hs01_00042293 predicted 1201
3 SASI_Hs01_00042294 predicted 556
4 SASI_Hs01_00042295 predicted 783
5 SASI_Hs01_00042296 predicted 688
6 SASI_Hs01_00042297 predicted 1097
7 SASI_Hs01_00042298 predicted 1265
8 SASI_Hs01_00042299 predicted 991
9 SASI_Hs01_00042300 predicted 1012
10 SASI_Hs01_00042301 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270356 predicted 1025
2 SASI_Rn01_00045074 predicted 1001
3 SASI_Rn01_00045075 predicted 1253
4 SASI_Rn01_00045076 predicted 1116
5 SASI_Rn01_00045077 predicted 849
6 SASI_Rn01_00045078 predicted 1105
7 SASI_Rn01_00045079 predicted 749
8 SASI_Rn01_00045081 predicted 1716
9 SASI_Rn02_00270357 predicted 1394
10 SASI_Rn02_00270358 predicted 1411
11 SASI_Rn01_00045073 predicted 1634
12 SASI_Rn01_00045080 predicted 1249
13 SASI_Rn01_00045082 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126373 predicted 950
2 SASI_Mm01_00126374 predicted 601
3 SASI_Mm01_00126375 predicted 341
4 SASI_Mm01_00126376 predicted 983
5 SASI_Mm01_00126377 predicted 848
6 SASI_Mm01_00126379 predicted 1179
7 SASI_Mm02_00321778 predicted 967
8 SASI_Mm01_00126380 predicted 1243
9 SASI_Mm01_00126381 predicted 1099
10 SASI_Mm01_00126382 predicted 1264
11 SASI_Mm01_00126378 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011935
ESRRG MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011935.2-1156s21c1
Sequence:CCGGGCAGGCCTTCTTGACCTAAATCTCGAGATTTAGGTCAAGAAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1620s21c1
Sequence:CCGGCAACAGACTGCACTGATATTTCTCGAGAAATATCAGTGCAGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1923s21c1
Sequence:CCGGACTCTGCGTACATAGTCAATACTCGAGTATTGACTATGTACGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1581s21c1
Sequence:CCGGGTCGAAGAATCTTAGAGTTTACTCGAGTAAACTCTAAGATTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-567s1c1
Sequence:CCGGCGAATGAATGTGAGATCACAACTCGAGTTGTGATCTCACATTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-700s1c1
Sequence:CCGGGCGCAGAATAGATGCTGAGAACTCGAGTTCTCAGCATCTATTCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-887s1c1
Sequence:CCGGCGAGAGTTGGTGGTTATCATTCTCGAGAATGATAACCACCAACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-515s1c1
Sequence:CCGGGCATTCTTCAAGAGGACGATTCTCGAGAATCGTCCTCTTGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-1363s1c1
Sequence:CCGGCCAGCACTTCTACAACATCAACTCGAGTTGATGTTGTAGAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011935
ESRRG MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011935.2-1156s21c1
Sequence:CCGGGCAGGCCTTCTTGACCTAAATCTCGAGATTTAGGTCAAGAAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1620s21c1
Sequence:CCGGCAACAGACTGCACTGATATTTCTCGAGAAATATCAGTGCAGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1923s21c1
Sequence:CCGGACTCTGCGTACATAGTCAATACTCGAGTATTGACTATGTACGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1581s21c1
Sequence:CCGGGTCGAAGAATCTTAGAGTTTACTCGAGTAAACTCTAAGATTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-567s1c1
Sequence:CCGGCGAATGAATGTGAGATCACAACTCGAGTTGTGATCTCACATTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-700s1c1
Sequence:CCGGGCGCAGAATAGATGCTGAGAACTCGAGTTCTCAGCATCTATTCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-887s1c1
Sequence:CCGGCGAGAGTTGGTGGTTATCATTCTCGAGAATGATAACCACCAACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-515s1c1
Sequence:CCGGGCATTCTTCAAGAGGACGATTCTCGAGAATCGTCCTCTTGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-1363s1c1
Sequence:CCGGCCAGCACTTCTACAACATCAACTCGAGTTGATGTTGTAGAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011935
ESRRG MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011935.2-1156s21c1
Sequence:CCGGGCAGGCCTTCTTGACCTAAATCTCGAGATTTAGGTCAAGAAGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1620s21c1
Sequence:CCGGCAACAGACTGCACTGATATTTCTCGAGAAATATCAGTGCAGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1923s21c1
Sequence:CCGGACTCTGCGTACATAGTCAATACTCGAGTATTGACTATGTACGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011935.2-1581s21c1
Sequence:CCGGGTCGAAGAATCTTAGAGTTTACTCGAGTAAACTCTAAGATTCTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-567s1c1
Sequence:CCGGCGAATGAATGTGAGATCACAACTCGAGTTGTGATCTCACATTCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-700s1c1
Sequence:CCGGGCGCAGAATAGATGCTGAGAACTCGAGTTCTCAGCATCTATTCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-887s1c1
Sequence:CCGGCGAGAGTTGGTGGTTATCATTCTCGAGAATGATAACCACCAACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-515s1c1
Sequence:CCGGGCATTCTTCAAGAGGACGATTCTCGAGAATCGTCCTCTTGAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011935.1-1363s1c1
Sequence:CCGGCCAGCACTTCTACAACATCAACTCGAGTTGATGTTGTAGAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206595
ESRRG MISSION shRNA Bacterial Glycerol Stock
estrogen-related receptor gamma
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206595.1-1807s1c1
Sequence:CCGGCCCTTATTTCTTTGCTTCTTTCTCGAGAAAGAAGCAAAGAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-664s1c1
Sequence:CCGGCGAATGAATGTGAAATCACAACTCGAGTTGTGATTTCACATTCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-956s1c1
Sequence:CCGGCCTCACTACACTGTGTGACTTCTCGAGAAGTCACACAGTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-450s1c1
Sequence:CCGGCCTGTCAGGAAACTGTATGATCTCGAGATCATACAGTTTCCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-1110s1c1
Sequence:CCGGCGGTCTCTTTCGTTTGAGGATCTCGAGATCCTCAAACGAAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206595
ESRRG MISSION shRNA shRNA Plasmid DNA
estrogen-related receptor gamma
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206595.1-1807s1c1
Sequence:CCGGCCCTTATTTCTTTGCTTCTTTCTCGAGAAAGAAGCAAAGAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-664s1c1
Sequence:CCGGCGAATGAATGTGAAATCACAACTCGAGTTGTGATTTCACATTCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-956s1c1
Sequence:CCGGCCTCACTACACTGTGTGACTTCTCGAGAAGTCACACAGTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-450s1c1
Sequence:CCGGCCTGTCAGGAAACTGTATGATCTCGAGATCATACAGTTTCCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-1110s1c1
Sequence:CCGGCGGTCTCTTTCGTTTGAGGATCTCGAGATCCTCAAACGAAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206595
ESRRG MISSION shRNA Lentiviral Transduction Particles
estrogen-related receptor gamma
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206595.1-1807s1c1
Sequence:CCGGCCCTTATTTCTTTGCTTCTTTCTCGAGAAAGAAGCAAAGAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-664s1c1
Sequence:CCGGCGAATGAATGTGAAATCACAACTCGAGTTGTGATTTCACATTCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-956s1c1
Sequence:CCGGCCTCACTACACTGTGTGACTTCTCGAGAAGTCACACAGTGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-450s1c1
Sequence:CCGGCCTGTCAGGAAACTGTATGATCTCGAGATCATACAGTTTCCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206595.1-1110s1c1
Sequence:CCGGCGGTCTCTTTCGTTTGAGGATCTCGAGATCCTCAAACGAAAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks