EMAIL THIS PAGE TO A FRIEND

ESX1

ESX homeobox 1

Synonyms: ESX1L ESXR1
UniProtKB ID: Q8N693, B0QYU3, Q7Z6K7
Gene ID:
Human(80712) Summary: This gene encodes a dual-function 65 kDa protein that undergoes proteolytic cleavage to produce a 45 kDa N-terminal fragment with a paired-like homeodomain and a 20 kDa C-terminal fragment with a proline-rich domain. The C-terminal fragment localizes to the cytoplasm while the N-terminal fragment localizes exclusively to the nucleus. In contrast to human, the mouse homolog has a novel PN/PF motif in the C-terminus and is paternally imprinted in placental tissue. This gene likely plays a role in placental development and spermatogenesis. [provided by RefSeq, Jan 2010]
Mouse(13984) extraembryonic, spermatogenesis, homeobox 1
cow(616174) ESX homeobox 1
domestic cat(101082983) ESX homeobox 1
sheep(101118426) ESX homeobox 1
naked mole-rat(101715761) ESX homeobox 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153448 Rosetta Predictions human pricing
NM_007957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058491 predicted 200
2 SASI_Hs02_00367287 predicted 577
3 SASI_Hs02_00367288 predicted 542
4 SASI_Hs01_00058492 predicted 715
5 SASI_Hs01_00058494 predicted 738
6 SASI_Hs01_00058497 predicted 769
7 SASI_Hs02_00367289 predicted 666
8 SASI_Hs01_00058498 predicted 328
9 SASI_Hs01_00058499 predicted 562
10 SASI_Hs02_00367290 predicted 740
11 SASI_Hs01_00058493 predicted 219
12 SASI_Hs01_00058495 predicted 570
13 SASI_Hs01_00058496 predicted 663
14 SASI_Hs01_00058500 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312832 predicted 385
2 SASI_Mm02_00312833 predicted 372
3 SASI_Mm02_00312834 predicted 511
4 SASI_Mm02_00312835 predicted 436
5 SASI_Mm01_00147829 predicted 1089
6 SASI_Mm02_00312836 predicted 364
7 SASI_Mm02_00312837 predicted 317
8 SASI_Mm02_00312838 predicted 493
9 SASI_Mm02_00312839 predicted 380
10 SASI_Mm01_00147833 predicted 1079
11 SASI_Mm01_00147826 predicted 1173
12 SASI_Mm01_00147827 predicted 1118
13 SASI_Mm01_00147828 predicted 1124
14 SASI_Mm01_00147830 predicted 1176
15 SASI_Mm01_00147831 predicted 1168
16 SASI_Mm01_00147832 predicted 1174
17 SASI_Mm01_00147834 predicted 1178
18 SASI_Mm01_00147835 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153448
ESX1 MISSION shRNA Bacterial Glycerol Stock
ESX homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-1241s1c1
Sequence:CCGGCCTGTCATCAACAGTTATTATCTCGAGATAATAACTGTTGATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-188s1c1
Sequence:CCGGGAGGAGAATACACGGTCCAAACTCGAGTTTGGACCGTGTATTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-536s1c1
Sequence:CCGGGAATCTCAATATCCCGACGTTCTCGAGAACGTCGGGATATTGAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-131s1c1
Sequence:CCGGGAAGTGAATGATGAGAAACTTCTCGAGAAGTTTCTCATCATTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-652s1c1
Sequence:CCGGGAGGGTGCTAATGTTGAGAAACTCGAGTTTCTCAACATTAGCACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-582s21c1
Sequence:CCGGACTTGCAGCACGCCTGAATTTCTCGAGAAATTCAGGCGTGCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-1287s21c1
Sequence:CCGGCTAAAGTAAGGTATTCATAACCTCGAGGTTATGAATACCTTACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1434s21c1
Sequence:CCGGAGGCCACATAATTGTAGTATTCTCGAGAATACTACAATTATGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1366s21c1
Sequence:CCGGATTCGTTAGATGCTTGTTAAACTCGAGTTTAACAAGCATCTAACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153448
ESX1 MISSION shRNA shRNA Plasmid DNA
ESX homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-1241s1c1
Sequence:CCGGCCTGTCATCAACAGTTATTATCTCGAGATAATAACTGTTGATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-188s1c1
Sequence:CCGGGAGGAGAATACACGGTCCAAACTCGAGTTTGGACCGTGTATTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-536s1c1
Sequence:CCGGGAATCTCAATATCCCGACGTTCTCGAGAACGTCGGGATATTGAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-131s1c1
Sequence:CCGGGAAGTGAATGATGAGAAACTTCTCGAGAAGTTTCTCATCATTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-652s1c1
Sequence:CCGGGAGGGTGCTAATGTTGAGAAACTCGAGTTTCTCAACATTAGCACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-582s21c1
Sequence:CCGGACTTGCAGCACGCCTGAATTTCTCGAGAAATTCAGGCGTGCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-1287s21c1
Sequence:CCGGCTAAAGTAAGGTATTCATAACCTCGAGGTTATGAATACCTTACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1434s21c1
Sequence:CCGGAGGCCACATAATTGTAGTATTCTCGAGAATACTACAATTATGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1366s21c1
Sequence:CCGGATTCGTTAGATGCTTGTTAAACTCGAGTTTAACAAGCATCTAACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153448
ESX1 MISSION shRNA Lentiviral Transduction Particles
ESX homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-1241s1c1
Sequence:CCGGCCTGTCATCAACAGTTATTATCTCGAGATAATAACTGTTGATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-188s1c1
Sequence:CCGGGAGGAGAATACACGGTCCAAACTCGAGTTTGGACCGTGTATTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-536s1c1
Sequence:CCGGGAATCTCAATATCCCGACGTTCTCGAGAACGTCGGGATATTGAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-131s1c1
Sequence:CCGGGAAGTGAATGATGAGAAACTTCTCGAGAAGTTTCTCATCATTCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153448.2-652s1c1
Sequence:CCGGGAGGGTGCTAATGTTGAGAAACTCGAGTTTCTCAACATTAGCACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-582s21c1
Sequence:CCGGACTTGCAGCACGCCTGAATTTCTCGAGAAATTCAGGCGTGCTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153448.3-1287s21c1
Sequence:CCGGCTAAAGTAAGGTATTCATAACCTCGAGGTTATGAATACCTTACTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1434s21c1
Sequence:CCGGAGGCCACATAATTGTAGTATTCTCGAGAATACTACAATTATGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153448.3-1366s21c1
Sequence:CCGGATTCGTTAGATGCTTGTTAAACTCGAGTTTAACAAGCATCTAACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007957
ESX1 MISSION shRNA Bacterial Glycerol Stock
ESX homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1201s1c1
Sequence:CCGGCCATCCCTATTGTGGAGGTTACTCGAGTAACCTCCACAATAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1063s1c1
Sequence:CCGGCTGAACCTAGAGTGCAGGTTTCTCGAGAAACCTGCACTCTAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-702s1c1
Sequence:CCGGCAAGCCTGGAATGGGAATGAACTCGAGTTCATTCCCATTCCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1170s1c1
Sequence:CCGGGTGGGTGTCTATCTTGATGATCTCGAGATCATCAAGATAGACACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1257s1c1
Sequence:CCGGCATCCTCAAATGATGCCTCTTCTCGAGAAGAGGCATCATTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-453s21c1
Sequence:CCGGCAACTTTCTACTCCGACTTTGCTCGAGCAAAGTCGGAGTAGAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-1212s21c1
Sequence:CCGGTCAGAATGCCTCCACCATTTACTCGAGTAAATGGTGGAGGCATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007957
ESX1 MISSION shRNA shRNA Plasmid DNA
ESX homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1201s1c1
Sequence:CCGGCCATCCCTATTGTGGAGGTTACTCGAGTAACCTCCACAATAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1063s1c1
Sequence:CCGGCTGAACCTAGAGTGCAGGTTTCTCGAGAAACCTGCACTCTAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-702s1c1
Sequence:CCGGCAAGCCTGGAATGGGAATGAACTCGAGTTCATTCCCATTCCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1170s1c1
Sequence:CCGGGTGGGTGTCTATCTTGATGATCTCGAGATCATCAAGATAGACACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1257s1c1
Sequence:CCGGCATCCTCAAATGATGCCTCTTCTCGAGAAGAGGCATCATTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-453s21c1
Sequence:CCGGCAACTTTCTACTCCGACTTTGCTCGAGCAAAGTCGGAGTAGAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-1212s21c1
Sequence:CCGGTCAGAATGCCTCCACCATTTACTCGAGTAAATGGTGGAGGCATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007957
ESX1 MISSION shRNA Lentiviral Transduction Particles
ESX homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1201s1c1
Sequence:CCGGCCATCCCTATTGTGGAGGTTACTCGAGTAACCTCCACAATAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1063s1c1
Sequence:CCGGCTGAACCTAGAGTGCAGGTTTCTCGAGAAACCTGCACTCTAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-702s1c1
Sequence:CCGGCAAGCCTGGAATGGGAATGAACTCGAGTTCATTCCCATTCCAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1170s1c1
Sequence:CCGGGTGGGTGTCTATCTTGATGATCTCGAGATCATCAAGATAGACACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007957.1-1257s1c1
Sequence:CCGGCATCCTCAAATGATGCCTCTTCTCGAGAAGAGGCATCATTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-453s21c1
Sequence:CCGGCAACTTTCTACTCCGACTTTGCTCGAGCAAAGTCGGAGTAGAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007957.2-1212s21c1
Sequence:CCGGTCAGAATGCCTCCACCATTTACTCGAGTAAATGGTGGAGGCATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks