EMAIL THIS PAGE TO A FRIEND

ESYT1

extended synaptotagmin-like protein 1

Synonyms: FAM62A MBC2
Gene ID:
Mouse(23943) extended synaptotagmin-like protein 1
Rat(29579) extended synaptotagmin-like protein 1
cow(520669) extended synaptotagmin-like protein 1
Horse(100051975) extended synaptotagmin-like protein 1
dog(474397) extended synaptotagmin-like protein 1
domestic cat(101095348) extended synaptotagmin-like protein 1
naked mole-rat(101719802) extended synaptotagmin-like protein 1
domestic guinea pig(100735769) extended synaptotagmin-like protein 1
sheep(101111441) extended synaptotagmin-like protein 1
Domestic Rabbit(100343457) extended synaptotagmin-like protein 1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015292 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041551 MISSION® esiRNA esiRNA human FAM62A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015292 Rosetta Predictions human pricing
NM_017249 Rosetta Predictions rat pricing
NM_011843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188940 predicted 1198
2 SASI_Hs01_00188941 predicted 855
3 SASI_Hs02_00347481 predicted 2264
4 SASI_Hs01_00188942 predicted 457
5 SASI_Hs02_00347482 predicted 2981
6 SASI_Hs01_00188943 predicted 780
7 SASI_Hs01_00188945 predicted 2993
8 SASI_Hs01_00188946 predicted 3417
9 SASI_Hs01_00188948 predicted 1411
10 SASI_Hs02_00347483 predicted 1068
11 SASI_Hs01_00188944 predicted 1366
12 SASI_Hs01_00188947 predicted 1804
13 SASI_Hs01_00188949 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052383 predicted 630
2 SASI_Rn01_00052384 predicted 1047
3 SASI_Rn01_00052385 predicted 3135
4 SASI_Rn02_00261637 predicted 3120
5 SASI_Rn01_00052386 predicted 282
6 SASI_Rn01_00052387 predicted 1351
7 SASI_Rn01_00052388 predicted 870
8 SASI_Rn01_00052389 predicted 792
9 SASI_Rn01_00052390 predicted 1102
10 SASI_Rn01_00052391 predicted 3233
11 SASI_Rn01_00052392 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024662 predicted 612
2 SASI_Mm02_00321576 predicted 1508
3 SASI_Mm01_00024663 predicted 580
4 SASI_Mm01_00024664 predicted 1158
5 SASI_Mm01_00024666 predicted 603
6 SASI_Mm01_00024667 predicted 2957
7 SASI_Mm01_00024668 predicted 814
8 SASI_Mm01_00024669 predicted 588
9 SASI_Mm02_00321577 predicted 2464
10 SASI_Mm01_00024671 predicted 1319
11 SASI_Mm01_00024665 predicted 987
12 SASI_Mm01_00024670 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011843
ESYT1 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011843.2-3516s21c1
Sequence:CCGGAGGGACCTGAGCTGGCTATTTCTCGAGAAATAGCCAGCTCAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.2-834s1c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-834s21c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-578s21c1
Sequence:CCGGTACGAATCATTGGCGTCAAAGCTCGAGCTTTGACGCCAATGATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-350s21c1
Sequence:CCGGTCACCGCAGAGACGCTTTATACTCGAGTATAAAGCGTCTCTGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-1958s21c1
Sequence:CCGGTAGAAGCGCAGGACCTAATTGCTCGAGCAATTAGGTCCTGCGCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-643s1c1
Sequence:CCGGGTCAGCTATGTAGGTGATGTACTCGAGTACATCACCTACATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-3103s1c1
Sequence:CCGGCCTGAGTTCAATGAGCGGTTTCTCGAGAAACCGCTCATTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011843.1-3545s1c1
Sequence:CCGGGCCTGTTACCTCTTCCTTCTTCTCGAGAAGAAGGAAGAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011843
ESYT1 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011843.2-3516s21c1
Sequence:CCGGAGGGACCTGAGCTGGCTATTTCTCGAGAAATAGCCAGCTCAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.2-834s1c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-834s21c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-578s21c1
Sequence:CCGGTACGAATCATTGGCGTCAAAGCTCGAGCTTTGACGCCAATGATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-350s21c1
Sequence:CCGGTCACCGCAGAGACGCTTTATACTCGAGTATAAAGCGTCTCTGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-1958s21c1
Sequence:CCGGTAGAAGCGCAGGACCTAATTGCTCGAGCAATTAGGTCCTGCGCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-643s1c1
Sequence:CCGGGTCAGCTATGTAGGTGATGTACTCGAGTACATCACCTACATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-3103s1c1
Sequence:CCGGCCTGAGTTCAATGAGCGGTTTCTCGAGAAACCGCTCATTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011843.1-3545s1c1
Sequence:CCGGGCCTGTTACCTCTTCCTTCTTCTCGAGAAGAAGGAAGAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011843
ESYT1 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011843.2-3516s21c1
Sequence:CCGGAGGGACCTGAGCTGGCTATTTCTCGAGAAATAGCCAGCTCAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.2-834s1c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-834s21c1
Sequence:CCGGGATGACCAACCTGCTAGATATCTCGAGATATCTAGCAGGTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-578s21c1
Sequence:CCGGTACGAATCATTGGCGTCAAAGCTCGAGCTTTGACGCCAATGATTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-350s21c1
Sequence:CCGGTCACCGCAGAGACGCTTTATACTCGAGTATAAAGCGTCTCTGCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011843.2-1958s21c1
Sequence:CCGGTAGAAGCGCAGGACCTAATTGCTCGAGCAATTAGGTCCTGCGCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-643s1c1
Sequence:CCGGGTCAGCTATGTAGGTGATGTACTCGAGTACATCACCTACATAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011843.1-3103s1c1
Sequence:CCGGCCTGAGTTCAATGAGCGGTTTCTCGAGAAACCGCTCATTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011843.1-3545s1c1
Sequence:CCGGGCCTGTTACCTCTTCCTTCTTCTCGAGAAGAAGGAAGAGGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015292
VALIDATED
ESYT1 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-954s21c1
Sequence:CCGGCTCGTGTTGCCCAACCGATTACTCGAGTAATCGGTTGGGCAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1797s21c1
Sequence:CCGGCCAAACTCCAGACTCTATATGCTCGAGCATATAGAGTCTGGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3485s21c1
Sequence:CCGGTTCACCTAACAGGCCCATATTCTCGAGAATATGGGCCTGTTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3216s21c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1256s21c1
Sequence:CCGGGTTCGACAAGGATCCAGATAACTCGAGTTATCTGGATCCTTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-2258s1c1
Sequence:CCGGGCGTCTCACCACAGTCTTAAACTCGAGTTTAAGACTGTGGTGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3216s1c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3544s1c1
Sequence:CCGGCCTTTACTGCACGGCCTTTATCTCGAGATAAAGGCCGTGCAGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-707s1c1
Sequence:CCGGGCAGATTGATGTGGAAGTGAACTCGAGTTCACTTCCACATCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-1200s1c1
Sequence:CCGGGAGACTTATGAGGTGATGGTACTCGAGTACCATCACCTCATAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015292
VALIDATED
ESYT1 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-954s21c1
Sequence:CCGGCTCGTGTTGCCCAACCGATTACTCGAGTAATCGGTTGGGCAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1797s21c1
Sequence:CCGGCCAAACTCCAGACTCTATATGCTCGAGCATATAGAGTCTGGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3485s21c1
Sequence:CCGGTTCACCTAACAGGCCCATATTCTCGAGAATATGGGCCTGTTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3216s21c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1256s21c1
Sequence:CCGGGTTCGACAAGGATCCAGATAACTCGAGTTATCTGGATCCTTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-2258s1c1
Sequence:CCGGGCGTCTCACCACAGTCTTAAACTCGAGTTTAAGACTGTGGTGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3216s1c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3544s1c1
Sequence:CCGGCCTTTACTGCACGGCCTTTATCTCGAGATAAAGGCCGTGCAGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-707s1c1
Sequence:CCGGGCAGATTGATGTGGAAGTGAACTCGAGTTCACTTCCACATCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-1200s1c1
Sequence:CCGGGAGACTTATGAGGTGATGGTACTCGAGTACCATCACCTCATAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015292
VALIDATED
ESYT1 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-954s21c1
Sequence:CCGGCTCGTGTTGCCCAACCGATTACTCGAGTAATCGGTTGGGCAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1797s21c1
Sequence:CCGGCCAAACTCCAGACTCTATATGCTCGAGCATATAGAGTCTGGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3485s21c1
Sequence:CCGGTTCACCTAACAGGCCCATATTCTCGAGAATATGGGCCTGTTAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-3216s21c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015292.1-1256s21c1
Sequence:CCGGGTTCGACAAGGATCCAGATAACTCGAGTTATCTGGATCCTTGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-2258s1c1
Sequence:CCGGGCGTCTCACCACAGTCTTAAACTCGAGTTTAAGACTGTGGTGAGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3216s1c1
Sequence:CCGGGATGTCTCTGTCAAGTCTAATCTCGAGATTAGACTTGACAGAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-3544s1c1
Sequence:CCGGCCTTTACTGCACGGCCTTTATCTCGAGATAAAGGCCGTGCAGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-707s1c1
Sequence:CCGGGCAGATTGATGTGGAAGTGAACTCGAGTTCACTTCCACATCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015292.x-1200s1c1
Sequence:CCGGGAGACTTATGAGGTGATGGTACTCGAGTACCATCACCTCATAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks