EMAIL THIS PAGE TO A FRIEND

ESYT2

extended synaptotagmin-like protein 2

97 Gene Product Result for
Synonyms: CHR2SYT E-Syt2 FAM62B
Gene ID:
Mouse(52635) extended synaptotagmin-like protein 2
Rat(299488) extended synaptotagmin-like protein 2
fruit fly(42929) CG6643 gene product from transcript CG6643-RA
domestic cat(101089930) extended synaptotagmin-like protein 2
cow(512582) extended synaptotagmin-like protein 2
Horse(100057949) extended synaptotagmin-like protein 2
dog(100683048) extended synaptotagmin-like protein 2
sheep(101118945) extended synaptotagmin-like protein 2
domestic guinea pig(100724846) extended synaptotagmin-like protein 2
naked mole-rat(101714801) extended synaptotagmin-like protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020728 Rosetta Predictions human pricing
XM_234709 Rosetta Predictions rat pricing
XR_007908 Rosetta Predictions rat pricing
NM_028731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015358 predicted 2530
2 SASI_Hs02_00353795 predicted 553
3 SASI_Hs01_00015359 predicted 2029
4 SASI_Hs01_00015360 predicted 913
5 SASI_Hs02_00353796 predicted 1386
6 SASI_Hs01_00015361 predicted 1584
7 SASI_Hs01_00015362 predicted 2699
8 SASI_Hs01_00015366 predicted 2644
9 SASI_Hs02_00353797 predicted 1078
10 SASI_Hs01_00015367 predicted 582
11 SASI_Hs01_00015363 predicted 2116
12 SASI_Hs01_00015364 predicted 671
13 SASI_Hs01_00015365 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181663 predicted 2202
2 SASI_Rn01_00181664 predicted 1799
3 SASI_Rn01_00181665 predicted 830
4 SASI_Rn01_00181666 predicted 1112
5 SASI_Rn01_00181667 predicted 1499
6 SASI_Rn01_00181668 predicted 2553
7 SASI_Rn01_00181669 predicted 2136
8 SASI_Rn01_00181670 predicted 2875
9 SASI_Rn01_00181671 predicted 1118
10 SASI_Rn01_00181672 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151372 predicted 2093
2 SASI_Rn01_00151373 predicted 1696
3 SASI_Rn01_00151374 predicted 665
4 SASI_Rn01_00151375 predicted 945
5 SASI_Rn01_00151376 predicted 1329
6 SASI_Rn01_00151377 predicted 1558
7 SASI_Rn01_00151378 predicted 2442
8 SASI_Rn01_00151380 predicted 952
9 SASI_Rn01_00151381 predicted 2378
10 SASI_Rn02_00415781 predicted 1837
11 SASI_Rn01_00151379 predicted 2033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195532 predicted 1603
2 SASI_Mm01_00195533 predicted 498
3 SASI_Mm01_00195535 predicted 1295
4 SASI_Mm01_00195536 predicted 637
5 SASI_Mm02_00334294 predicted 1149
6 SASI_Mm02_00334295 predicted 1028
7 SASI_Mm01_00195537 predicted 1211
8 SASI_Mm01_00195538 predicted 1748
9 SASI_Mm01_00195540 predicted 1044
10 SASI_Mm01_00195541 predicted 2000
11 SASI_Mm01_00195534 predicted 1007
12 SASI_Mm01_00195539 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020728
VALIDATED
ESYT2 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1123s1c1
Sequence:CCGGCCTGTACCAAAGGGTGTTCTACTCGAGTAGAACACCCTTTGGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-557s1c1
Sequence:CCGGCTGAAAGAGCAGAATGGCTAACTCGAGTTAGCCATTCTGCTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-2530s1c1
Sequence:CCGGCCAGTGTTTGATCAAAGCTTTCTCGAGAAAGCTTTGATCAAACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2641s1c1
Sequence:CCGGCTCCTTGGCAAAGTATTGGTTCTCGAGAACCAATACTTTGCCAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1318s1c1
Sequence:CCGGGTGTATGAACATCCTGGACAACTCGAGTTGTCCAGGATGTTCATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-4497s1c1
Sequence:CCGGGCGACTGTAAAGCCTCTTTATCTCGAGATAAAGAGGCTTTACAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2372s1c1
Sequence:CCGGGCTCGCAGAGAAACAAGCTTACTCGAGTAAGCTTGTTTCTCTGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-5298s1c1
Sequence:CCGGGCCTTAAAGTAGGAAGGTGTTCTCGAGAACACCTTCCTACTTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1660s1c1
Sequence:CCGGCCTGTTGTCCAGATGTCAGTTCTCGAGAACTGACATCTGGACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1692s1c1
Sequence:CCGGCCAGGAGAGCAAGATTCGATACTCGAGTATCGAATCTTGCTCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020728
VALIDATED
ESYT2 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1123s1c1
Sequence:CCGGCCTGTACCAAAGGGTGTTCTACTCGAGTAGAACACCCTTTGGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-557s1c1
Sequence:CCGGCTGAAAGAGCAGAATGGCTAACTCGAGTTAGCCATTCTGCTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-2530s1c1
Sequence:CCGGCCAGTGTTTGATCAAAGCTTTCTCGAGAAAGCTTTGATCAAACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2641s1c1
Sequence:CCGGCTCCTTGGCAAAGTATTGGTTCTCGAGAACCAATACTTTGCCAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1318s1c1
Sequence:CCGGGTGTATGAACATCCTGGACAACTCGAGTTGTCCAGGATGTTCATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-4497s1c1
Sequence:CCGGGCGACTGTAAAGCCTCTTTATCTCGAGATAAAGAGGCTTTACAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2372s1c1
Sequence:CCGGGCTCGCAGAGAAACAAGCTTACTCGAGTAAGCTTGTTTCTCTGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-5298s1c1
Sequence:CCGGGCCTTAAAGTAGGAAGGTGTTCTCGAGAACACCTTCCTACTTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1660s1c1
Sequence:CCGGCCTGTTGTCCAGATGTCAGTTCTCGAGAACTGACATCTGGACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1692s1c1
Sequence:CCGGCCAGGAGAGCAAGATTCGATACTCGAGTATCGAATCTTGCTCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020728
VALIDATED
ESYT2 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1123s1c1
Sequence:CCGGCCTGTACCAAAGGGTGTTCTACTCGAGTAGAACACCCTTTGGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-557s1c1
Sequence:CCGGCTGAAAGAGCAGAATGGCTAACTCGAGTTAGCCATTCTGCTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-2530s1c1
Sequence:CCGGCCAGTGTTTGATCAAAGCTTTCTCGAGAAAGCTTTGATCAAACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2641s1c1
Sequence:CCGGCTCCTTGGCAAAGTATTGGTTCTCGAGAACCAATACTTTGCCAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1318s1c1
Sequence:CCGGGTGTATGAACATCCTGGACAACTCGAGTTGTCCAGGATGTTCATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-4497s1c1
Sequence:CCGGGCGACTGTAAAGCCTCTTTATCTCGAGATAAAGAGGCTTTACAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-2372s1c1
Sequence:CCGGGCTCGCAGAGAAACAAGCTTACTCGAGTAAGCTTGTTTCTCTGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020728.1-5298s1c1
Sequence:CCGGGCCTTAAAGTAGGAAGGTGTTCTCGAGAACACCTTCCTACTTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020728.1-1660s1c1
Sequence:CCGGCCTGTTGTCCAGATGTCAGTTCTCGAGAACTGACATCTGGACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020728.1-1692s1c1
Sequence:CCGGCCAGGAGAGCAAGATTCGATACTCGAGTATCGAATCTTGCTCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028731
VALIDATED
ESYT2 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-1305s21c1
Sequence:CCGGGTCTTATGATTGATCTTATTGCTCGAGCAATAAGATCAATCATAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1088s21c1
Sequence:CCGGGGCAAAGACACCTACCTTAAACTCGAGTTTAAGGTAGGTGTCTTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-712s21c1
Sequence:CCGGAGGAAATTGTGAGATTGATTTCTCGAGAAATCAATCTCACAATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-637s21c1
Sequence:CCGGAGTCAATGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028731.5-2661s21c1
Sequence:CCGGTACGCTGGACGTAGGTCTATTCTCGAGAATAGACCTACGTCCAGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-783s21c1
Sequence:CCGGATGGGACAATGCGGGTGATACCTCGAGGTATCACCCGCATTGTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1688s21c1
Sequence:CCGGGACCTTGAGGTTGAGGTTAAACTCGAGTTTAACCTCAACCTCAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-2011s21c1
Sequence:CCGGAGTCATGGGAGTCGATGATAACTCGAGTTATCATCGACTCCCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028731
VALIDATED
ESYT2 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-1305s21c1
Sequence:CCGGGTCTTATGATTGATCTTATTGCTCGAGCAATAAGATCAATCATAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1088s21c1
Sequence:CCGGGGCAAAGACACCTACCTTAAACTCGAGTTTAAGGTAGGTGTCTTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-712s21c1
Sequence:CCGGAGGAAATTGTGAGATTGATTTCTCGAGAAATCAATCTCACAATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-637s21c1
Sequence:CCGGAGTCAATGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028731.5-2661s21c1
Sequence:CCGGTACGCTGGACGTAGGTCTATTCTCGAGAATAGACCTACGTCCAGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-783s21c1
Sequence:CCGGATGGGACAATGCGGGTGATACCTCGAGGTATCACCCGCATTGTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1688s21c1
Sequence:CCGGGACCTTGAGGTTGAGGTTAAACTCGAGTTTAACCTCAACCTCAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-2011s21c1
Sequence:CCGGAGTCATGGGAGTCGATGATAACTCGAGTTATCATCGACTCCCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028731
VALIDATED
ESYT2 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-1305s21c1
Sequence:CCGGGTCTTATGATTGATCTTATTGCTCGAGCAATAAGATCAATCATAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1088s21c1
Sequence:CCGGGGCAAAGACACCTACCTTAAACTCGAGTTTAAGGTAGGTGTCTTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-712s21c1
Sequence:CCGGAGGAAATTGTGAGATTGATTTCTCGAGAAATCAATCTCACAATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-637s21c1
Sequence:CCGGAGTCAATGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028731.5-2661s21c1
Sequence:CCGGTACGCTGGACGTAGGTCTATTCTCGAGAATAGACCTACGTCCAGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-783s21c1
Sequence:CCGGATGGGACAATGCGGGTGATACCTCGAGGTATCACCCGCATTGTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028731.5-1688s21c1
Sequence:CCGGGACCTTGAGGTTGAGGTTAAACTCGAGTTTAACCTCAACCTCAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028731.5-2011s21c1
Sequence:CCGGAGTCATGGGAGTCGATGATAACTCGAGTTATCATCGACTCCCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)