EMAIL THIS PAGE TO A FRIEND

ESYT3

extended synaptotagmin-like protein 3

58 Gene Product Result for
Synonyms: CHR3SYT E-Syt3 FAM62C
UniProtKB ID: A0FGR9, A8K0G5, Q6ZV21, Q8NDZ5, Q9BQR9
Gene ID:
Mouse(272636) extended synaptotagmin-like protein 3
Rat(363120) extended synaptotagmin-like protein 3
Zebrafish(553238) extended synaptotagmin-like protein 3
dog(485686) extended synaptotagmin-like protein 3
cow(530157) extended synaptotagmin-like protein 3
Horse(100051874) extended synaptotagmin-like protein 3
domestic cat(101092537) extended synaptotagmin-like protein 3
naked mole-rat(101711197) extended synaptotagmin-like protein 3
domestic guinea pig(100731958) extended synaptotagmin-like protein 3
sheep(101112022) extended synaptotagmin-like protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031913 Rosetta Predictions human pricing
XM_001070598 Rosetta Predictions rat pricing
XM_343454 Rosetta Predictions rat pricing
NM_177775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216784 predicted 1293
2 SASI_Hs01_00216785 predicted 736
3 SASI_Hs01_00216786 predicted 2599
4 SASI_Hs01_00216787 predicted 848
5 SASI_Hs01_00216788 predicted 2436
6 SASI_Hs01_00216789 predicted 933
7 SASI_Hs01_00216790 predicted 2128
8 SASI_Hs02_00359038 predicted 2116
9 SASI_Hs01_00216791 predicted 2424
10 SASI_Hs01_00216792 predicted 689
11 SASI_Hs01_00216783 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332185 predicted 983
2 SASI_Rn02_00332186 predicted 893
3 SASI_Rn02_00332187 predicted 2476
4 SASI_Rn02_00332188 predicted 717
5 SASI_Rn02_00332189 predicted 1138
6 SASI_Rn02_00332190 predicted 737
7 SASI_Rn02_00332191 predicted 2399
8 SASI_Rn02_00332192 predicted 1262
9 SASI_Rn02_00332193 predicted 584
10 SASI_Rn02_00332194 predicted 2461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395784 predicted 1158
2 SASI_Rn02_00395785 predicted 1074
3 SASI_Rn02_00395786 predicted 2660
4 SASI_Rn02_00395787 predicted 892
5 SASI_Rn02_00395788 predicted 1316
6 SASI_Rn02_00395789 predicted 913
7 SASI_Rn02_00395790 predicted 2574
8 SASI_Rn02_00395791 predicted 1439
9 SASI_Rn02_00395792 predicted 762
10 SASI_Rn02_00395793 predicted 2644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153488 predicted 457
2 SASI_Mm01_00153489 predicted 526
3 SASI_Mm01_00153490 predicted 1222
4 SASI_Mm02_00348172 predicted 2911
5 SASI_Mm01_00153491 predicted 2358
6 SASI_Mm01_00153492 predicted 1220
7 SASI_Mm01_00153493 predicted 1536
8 SASI_Mm02_00348173 predicted 2730
9 SASI_Mm02_00348174 predicted 2876
10 SASI_Mm02_00348175 predicted 2414
11 SASI_Mm01_00153494 predicted 1277
12 SASI_Mm01_00153495 predicted 636
13 SASI_Mm01_00153496 predicted 2659
14 SASI_Mm01_00153497 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177775
ESYT3 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-677s21c1
Sequence:CCGGTCAAGGTACACACGGACAAACCTCGAGGTTTGTCCGTGTGTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1981s21c1
Sequence:CCGGGCCACCAACCAGGGTTGTAAACTCGAGTTTACAACCCTGGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1536s21c1
Sequence:CCGGTGACTATCTGAATGGTGAATACTCGAGTATTCACCATTCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177775.3-3246s21c1
Sequence:CCGGACGTGGAGCTGCAGTGTATTTCTCGAGAAATACACTGCAGCTCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1945s1c1
Sequence:CCGGCGCTCTAAAGAAAGGTCCTCTCTCGAGAGAGGACCTTTCTTTAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177775.2-3439s1c1
Sequence:CCGGCGGAGCCTTTATATTCTGTTACTCGAGTAACAGAATATAAAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1222s1c1
Sequence:CCGGCTGGAATGAAGTATTTGAGTTCTCGAGAACTCAAATACTTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-628s1c1
Sequence:CCGGCACCTTCACCAAGCTCTACTTCTCGAGAAGTAGAGCTTGGTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-2051s1c1
Sequence:CCGGCCTGCCTCTTACATCAAAGGACTCGAGTCCTTTGATGTAAGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177775
ESYT3 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-677s21c1
Sequence:CCGGTCAAGGTACACACGGACAAACCTCGAGGTTTGTCCGTGTGTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1981s21c1
Sequence:CCGGGCCACCAACCAGGGTTGTAAACTCGAGTTTACAACCCTGGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1536s21c1
Sequence:CCGGTGACTATCTGAATGGTGAATACTCGAGTATTCACCATTCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177775.3-3246s21c1
Sequence:CCGGACGTGGAGCTGCAGTGTATTTCTCGAGAAATACACTGCAGCTCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1945s1c1
Sequence:CCGGCGCTCTAAAGAAAGGTCCTCTCTCGAGAGAGGACCTTTCTTTAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177775.2-3439s1c1
Sequence:CCGGCGGAGCCTTTATATTCTGTTACTCGAGTAACAGAATATAAAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1222s1c1
Sequence:CCGGCTGGAATGAAGTATTTGAGTTCTCGAGAACTCAAATACTTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-628s1c1
Sequence:CCGGCACCTTCACCAAGCTCTACTTCTCGAGAAGTAGAGCTTGGTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-2051s1c1
Sequence:CCGGCCTGCCTCTTACATCAAAGGACTCGAGTCCTTTGATGTAAGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177775
ESYT3 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-677s21c1
Sequence:CCGGTCAAGGTACACACGGACAAACCTCGAGGTTTGTCCGTGTGTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1981s21c1
Sequence:CCGGGCCACCAACCAGGGTTGTAAACTCGAGTTTACAACCCTGGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177775.3-1536s21c1
Sequence:CCGGTGACTATCTGAATGGTGAATACTCGAGTATTCACCATTCAGATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177775.3-3246s21c1
Sequence:CCGGACGTGGAGCTGCAGTGTATTTCTCGAGAAATACACTGCAGCTCCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1945s1c1
Sequence:CCGGCGCTCTAAAGAAAGGTCCTCTCTCGAGAGAGGACCTTTCTTTAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177775.2-3439s1c1
Sequence:CCGGCGGAGCCTTTATATTCTGTTACTCGAGTAACAGAATATAAAGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-1222s1c1
Sequence:CCGGCTGGAATGAAGTATTTGAGTTCTCGAGAACTCAAATACTTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-628s1c1
Sequence:CCGGCACCTTCACCAAGCTCTACTTCTCGAGAAGTAGAGCTTGGTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177775.2-2051s1c1
Sequence:CCGGCCTGCCTCTTACATCAAAGGACTCGAGTCCTTTGATGTAAGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031913
ESYT3 MISSION shRNA Bacterial Glycerol Stock
extended synaptotagmin-like protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2849s21c1
Sequence:CCGGTGGTATGAGCTGACTCCAAATCTCGAGATTTGGAGTCAGCTCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031913.3-3059s21c1
Sequence:CCGGAGCATAAGGAAGAGGTTATTTCTCGAGAAATAACCTCTTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-747s21c1
Sequence:CCGGGTGTCAAGGCACACACTAATACTCGAGTATTAGTGTGTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-1609s21c1
Sequence:CCGGTGACTACCTGAATGGTGAATACTCGAGTATTCACCATTCAGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2442s21c1
Sequence:CCGGCAGATATCAGCCTCAACATTGCTCGAGCAATGTTGAGGCTGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031913.1-2335s1c1
Sequence:CCGGGCCTCTACTCTGAGTCACTATCTCGAGATAGTGACTCAGAGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1651s1c1
Sequence:CCGGGAGTGAAACAAGGTCAGCAAACTCGAGTTTGCTGACCTTGTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1676s1c1
Sequence:CCGGCTTCTTCCTATGTCAAACTATCTCGAGATAGTTTGACATAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031913
ESYT3 MISSION shRNA shRNA Plasmid DNA
extended synaptotagmin-like protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2849s21c1
Sequence:CCGGTGGTATGAGCTGACTCCAAATCTCGAGATTTGGAGTCAGCTCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031913.3-3059s21c1
Sequence:CCGGAGCATAAGGAAGAGGTTATTTCTCGAGAAATAACCTCTTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-747s21c1
Sequence:CCGGGTGTCAAGGCACACACTAATACTCGAGTATTAGTGTGTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-1609s21c1
Sequence:CCGGTGACTACCTGAATGGTGAATACTCGAGTATTCACCATTCAGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2442s21c1
Sequence:CCGGCAGATATCAGCCTCAACATTGCTCGAGCAATGTTGAGGCTGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031913.1-2335s1c1
Sequence:CCGGGCCTCTACTCTGAGTCACTATCTCGAGATAGTGACTCAGAGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1651s1c1
Sequence:CCGGGAGTGAAACAAGGTCAGCAAACTCGAGTTTGCTGACCTTGTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1676s1c1
Sequence:CCGGCTTCTTCCTATGTCAAACTATCTCGAGATAGTTTGACATAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031913
ESYT3 MISSION shRNA Lentiviral Transduction Particles
extended synaptotagmin-like protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2849s21c1
Sequence:CCGGTGGTATGAGCTGACTCCAAATCTCGAGATTTGGAGTCAGCTCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031913.3-3059s21c1
Sequence:CCGGAGCATAAGGAAGAGGTTATTTCTCGAGAAATAACCTCTTCCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-747s21c1
Sequence:CCGGGTGTCAAGGCACACACTAATACTCGAGTATTAGTGTGTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-1609s21c1
Sequence:CCGGTGACTACCTGAATGGTGAATACTCGAGTATTCACCATTCAGGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031913.3-2442s21c1
Sequence:CCGGCAGATATCAGCCTCAACATTGCTCGAGCAATGTTGAGGCTGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031913.1-2335s1c1
Sequence:CCGGGCCTCTACTCTGAGTCACTATCTCGAGATAGTGACTCAGAGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1651s1c1
Sequence:CCGGGAGTGAAACAAGGTCAGCAAACTCGAGTTTGCTGACCTTGTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031913.1-1676s1c1
Sequence:CCGGCTTCTTCCTATGTCAAACTATCTCGAGATAGTTTGACATAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks