EMAIL THIS PAGE TO A FRIEND

ETAA1

Ewing tumor-associated antigen 1

66 Gene Product Result for
Synonyms: ETAA16
UniProtKB ID: Q9NY74, Q05BT7, Q53SC4
Gene ID:
Mouse(68145) Ewing's tumor-associated antigen 1
Rat(498420) Ewing tumor-associated antigen 1
Zebrafish(558278) Ewing tumor-associated antigen 1
dog(474621) Ewing tumor-associated antigen 1
chicken(421269) Ewing tumor-associated antigen 1
cow(282224) Ewing tumor-associated antigen 1
domestic cat(101088922) Ewing tumor-associated antigen 1
sheep(101111788) Ewing tumor-associated antigen 1
domestic guinea pig(100722158) Ewing tumor-associated antigen 1
naked mole-rat(101697981) Ewing tumor-associated antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019002 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019002 Rosetta Predictions human pricing
NM_001109094 Rosetta Predictions rat pricing
NM_026576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352513 predicted 896
2 SASI_Hs01_00240946 predicted 2256
3 SASI_Hs01_00240947 predicted 687
4 SASI_Hs02_00352514 predicted 576
5 SASI_Hs01_00240950 predicted 2534
6 SASI_Hs01_00240951 predicted 2462
7 SASI_Hs01_00240952 predicted 2067
8 SASI_Hs01_00240953 predicted 1290
9 SASI_Hs01_00240955 predicted 501
10 SASI_Hs02_00352515 predicted 530
11 SASI_Hs01_00240948 predicted 850
12 SASI_Hs01_00240949 predicted 1664
13 SASI_Hs01_00240954 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245070 predicted 1365
2 SASI_Rn02_00245071 predicted 1170
3 SASI_Rn02_00245072 predicted 2210
4 SASI_Rn02_00245073 predicted 1191
5 SASI_Rn02_00245074 predicted 1754
6 SASI_Rn02_00245075 predicted 1525
7 SASI_Rn02_00245076 predicted 2248
8 SASI_Rn02_00245077 predicted 1627
9 SASI_Rn02_00245078 predicted 2185
10 SASI_Rn02_00245079 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076872 predicted 2429
2 SASI_Mm02_00330536 predicted 951
3 SASI_Mm01_00076873 predicted 2478
4 SASI_Mm01_00076874 predicted 1089
5 SASI_Mm01_00076875 predicted 1583
6 SASI_Mm01_00076876 predicted 2689
7 SASI_Mm01_00076877 predicted 1990
8 SASI_Mm01_00076878 predicted 1569
9 SASI_Mm01_00076879 predicted 1815
10 SASI_Mm01_00076880 predicted 2333
11 SASI_Mm01_00076871 predicted 1913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026576
VALIDATED
ETAA1 MISSION shRNA Bacterial Glycerol Stock
Ewing tumor-associated antigen 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-2536s1c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.1-1132s1c1
Sequence:CCGGCGTAATACTAAACTCATGTGTCTCGAGACACATGAGTTTAGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-920s1c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-427s1c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-1115s1c1
Sequence:CCGGCCTCAAATAGATACTACCGTACTCGAGTACGGTAGTATCTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-1035s1c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2700s1c1
Sequence:CCGGGATGGTTTCACAACTATTAATCTCGAGATTAATAGTTGTGAAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2845s1c1
Sequence:CCGGCAGAGATGTATGTGAATTATGCTCGAGCATAATTCACATACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1519s1c1
Sequence:CCGGGTCACTAGCATAGTTAGTAAACTCGAGTTTACTAACTATGCTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1592s1c1
Sequence:CCGGGCAATAAGTGCATACTTAATACTCGAGTATTAAGTATGCACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-895s21c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026576.2-2783s21c1
Sequence:CCGGAGCCTGAGCTTCTACTTTATTCTCGAGAATAAAGTAGAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-1010s21c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-2511s21c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-402s21c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026576
VALIDATED
ETAA1 MISSION shRNA shRNA Plasmid DNA
Ewing tumor-associated antigen 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-2536s1c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.1-1132s1c1
Sequence:CCGGCGTAATACTAAACTCATGTGTCTCGAGACACATGAGTTTAGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-920s1c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-427s1c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-1115s1c1
Sequence:CCGGCCTCAAATAGATACTACCGTACTCGAGTACGGTAGTATCTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-1035s1c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2700s1c1
Sequence:CCGGGATGGTTTCACAACTATTAATCTCGAGATTAATAGTTGTGAAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2845s1c1
Sequence:CCGGCAGAGATGTATGTGAATTATGCTCGAGCATAATTCACATACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1519s1c1
Sequence:CCGGGTCACTAGCATAGTTAGTAAACTCGAGTTTACTAACTATGCTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1592s1c1
Sequence:CCGGGCAATAAGTGCATACTTAATACTCGAGTATTAAGTATGCACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-895s21c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026576.2-2783s21c1
Sequence:CCGGAGCCTGAGCTTCTACTTTATTCTCGAGAATAAAGTAGAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-1010s21c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-2511s21c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-402s21c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026576
VALIDATED
ETAA1 MISSION shRNA Lentiviral Transduction Particles
Ewing tumor-associated antigen 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-2536s1c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.1-1132s1c1
Sequence:CCGGCGTAATACTAAACTCATGTGTCTCGAGACACATGAGTTTAGTATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-920s1c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-427s1c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026576.1-1115s1c1
Sequence:CCGGCCTCAAATAGATACTACCGTACTCGAGTACGGTAGTATCTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026576.1-1035s1c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215464    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2700s1c1
Sequence:CCGGGATGGTTTCACAACTATTAATCTCGAGATTAATAGTTGTGAAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026576.2-2845s1c1
Sequence:CCGGCAGAGATGTATGTGAATTATGCTCGAGCATAATTCACATACATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1519s1c1
Sequence:CCGGGTCACTAGCATAGTTAGTAAACTCGAGTTTACTAACTATGCTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026576.2-1592s1c1
Sequence:CCGGGCAATAAGTGCATACTTAATACTCGAGTATTAAGTATGCACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-895s21c1
Sequence:CCGGGCAGCCTTTAATGCTATATTTCTCGAGAAATATAGCATTAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026576.2-2783s21c1
Sequence:CCGGAGCCTGAGCTTCTACTTTATTCTCGAGAATAAAGTAGAAGCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-1010s21c1
Sequence:CCGGCCTTACTACAAGAGGAAATAACTCGAGTTATTTCCTCTTGTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-2511s21c1
Sequence:CCGGGCAGCAATCTTCAATAAACTACTCGAGTAGTTTATTGAAGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026576.2-402s21c1
Sequence:CCGGGCAGTTAGGTAAAGGAAGAAACTCGAGTTTCTTCCTTTACCTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019002
VALIDATED
ETAA1 MISSION shRNA Bacterial Glycerol Stock
Ewing tumor-associated antigen 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1067s1c1
Sequence:CCGGCCAGTAATACTACCTTTGTAACTCGAGTTACAAAGGTAGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-1233s1c1
Sequence:CCGGGCCAGAAACTTCTAATAAGTACTCGAGTACTTATTAGAAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-878s1c1
Sequence:CCGGCCGAAATAGATAATGCTACAACTCGAGTTGTAGCATTATCTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1799s1c1
Sequence:CCGGGCTCTGCAAATCTAGGCAGTACTCGAGTACTGCCTAGATTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-524s1c1
Sequence:CCGGCCACAGATAGTGATGAGATTTCTCGAGAAATCTCATCACTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-2945s21c1
Sequence:CCGGCGAAGACTGCTGATAACTATCCTCGAGGATAGTTATCAGCAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2362s21c1
Sequence:CCGGGATCTCAAACTGTCAGATAAACTCGAGTTTATCTGACAGTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3083s21c1
Sequence:CCGGCATTTCCTTGGACATGTATTTCTCGAGAAATACATGTCCAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1912s21c1
Sequence:CCGGAGCATGTCATCAATTAGATAACTCGAGTTATCTAATTGATGACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3058s21c1
Sequence:CCGGTCAATGTTTGCAATGGTAAATCTCGAGATTTACCATTGCAAACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-847s21c1
Sequence:CCGCGATGTGGTCATTACATAATATCTCGAGATATTATGTAATGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2254s21c1
Sequence:CCGGTTTGACAAATAGCTCACAAATCTCGAGATTTGTGAGCTATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2849s21c1
Sequence:CCGGGAAGCACTGGTTCGGAGAATGCTCGAGCATTCTCCGAACCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2558s21c1
Sequence:CCGGGAAGCTCAGAGCAACCTTAACCTCGAGGTTAAGGTTGCTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1175s21c1
Sequence:CCGGCAAGTAGATACACCCATAATGCTCGAGCATTATGGGTGTATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019002
VALIDATED
ETAA1 MISSION shRNA shRNA Plasmid DNA
Ewing tumor-associated antigen 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1067s1c1
Sequence:CCGGCCAGTAATACTACCTTTGTAACTCGAGTTACAAAGGTAGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-1233s1c1
Sequence:CCGGGCCAGAAACTTCTAATAAGTACTCGAGTACTTATTAGAAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-878s1c1
Sequence:CCGGCCGAAATAGATAATGCTACAACTCGAGTTGTAGCATTATCTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1799s1c1
Sequence:CCGGGCTCTGCAAATCTAGGCAGTACTCGAGTACTGCCTAGATTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-524s1c1
Sequence:CCGGCCACAGATAGTGATGAGATTTCTCGAGAAATCTCATCACTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-2945s21c1
Sequence:CCGGCGAAGACTGCTGATAACTATCCTCGAGGATAGTTATCAGCAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2362s21c1
Sequence:CCGGGATCTCAAACTGTCAGATAAACTCGAGTTTATCTGACAGTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3083s21c1
Sequence:CCGGCATTTCCTTGGACATGTATTTCTCGAGAAATACATGTCCAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1912s21c1
Sequence:CCGGAGCATGTCATCAATTAGATAACTCGAGTTATCTAATTGATGACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3058s21c1
Sequence:CCGGTCAATGTTTGCAATGGTAAATCTCGAGATTTACCATTGCAAACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-847s21c1
Sequence:CCGCGATGTGGTCATTACATAATATCTCGAGATATTATGTAATGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2254s21c1
Sequence:CCGGTTTGACAAATAGCTCACAAATCTCGAGATTTGTGAGCTATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2849s21c1
Sequence:CCGGGAAGCACTGGTTCGGAGAATGCTCGAGCATTCTCCGAACCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2558s21c1
Sequence:CCGGGAAGCTCAGAGCAACCTTAACCTCGAGGTTAAGGTTGCTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1175s21c1
Sequence:CCGGCAAGTAGATACACCCATAATGCTCGAGCATTATGGGTGTATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019002
VALIDATED
ETAA1 MISSION shRNA Lentiviral Transduction Particles
Ewing tumor-associated antigen 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1067s1c1
Sequence:CCGGCCAGTAATACTACCTTTGTAACTCGAGTTACAAAGGTAGTATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-1233s1c1
Sequence:CCGGGCCAGAAACTTCTAATAAGTACTCGAGTACTTATTAGAAGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-878s1c1
Sequence:CCGGCCGAAATAGATAATGCTACAACTCGAGTTGTAGCATTATCTATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019002.2-1799s1c1
Sequence:CCGGGCTCTGCAAATCTAGGCAGTACTCGAGTACTGCCTAGATTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019002.2-524s1c1
Sequence:CCGGCCACAGATAGTGATGAGATTTCTCGAGAAATCTCATCACTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-2945s21c1
Sequence:CCGGCGAAGACTGCTGATAACTATCCTCGAGGATAGTTATCAGCAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2362s21c1
Sequence:CCGGGATCTCAAACTGTCAGATAAACTCGAGTTTATCTGACAGTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3083s21c1
Sequence:CCGGCATTTCCTTGGACATGTATTTCTCGAGAAATACATGTCCAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1912s21c1
Sequence:CCGGAGCATGTCATCAATTAGATAACTCGAGTTATCTAATTGATGACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019002.3-3058s21c1
Sequence:CCGGTCAATGTTTGCAATGGTAAATCTCGAGATTTACCATTGCAAACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-847s21c1
Sequence:CCGCGATGTGGTCATTACATAATATCTCGAGATATTATGTAATGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2254s21c1
Sequence:CCGGTTTGACAAATAGCTCACAAATCTCGAGATTTGTGAGCTATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2849s21c1
Sequence:CCGGGAAGCACTGGTTCGGAGAATGCTCGAGCATTCTCCGAACCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-2558s21c1
Sequence:CCGGGAAGCTCAGAGCAACCTTAACCTCGAGGTTAAGGTTGCTCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019002.3-1175s21c1
Sequence:CCGGCAAGTAGATACACCCATAATGCTCGAGCATTATGGGTGTATCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks