EMAIL THIS PAGE TO A FRIEND

ETF1

eukaryotic translation termination factor 1

239 Gene Product Result for
Synonyms: D5S1995 ERF ERF1 RF1 SUP45L1 TB3-1
UniProtKB ID: P62495, B2R6B4, D3DQC1, P46055, Q5M7Z7
Gene ID:
Human(2107) Summary: This gene encodes a class-1 polypeptide chain release factor. The encoded protein plays an essential role in directing termination of mRNA translation from the termination codons UAA, UAG and UGA. This protein is a component of the SURF complex which promotes degradation of prematurely terminated mRNAs via the mechanism of nonsense-mediated mRNA decay (NMD). Alternate splicing results in coding and non-coding transcript variants. Pseudogenes of this gene are found on chromosomes 5, 7 and X. [provided by RefSeq, Jan 2012]
Mouse(225363) eukaryotic translation termination factor 1
Rat(307503) eukaryotic translation termination factor 1
Zebrafish(266989) eukaryotic translation termination factor 1
chicken(416182) eukaryotic translation termination factor 1
cow(541077) eukaryotic translation termination factor 1
Horse(100072563) eukaryotic translation termination factor 1
Horse(100069683) eukaryotic translation termination factor 1
domestic cat(101088644) eukaryotic translation termination factor 1
dog(608717) eukaryotic translation termination factor 1
sheep(101111800) eukaryotic translation termination factor 1
Domestic Rabbit(100009553) eukaryotic translation termination factor 1
naked mole-rat(101712814) eukaryotic translation termination factor 1
domestic guinea pig(100717687) eukaryotic translation termination factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004730 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004730 Rosetta Predictions human pricing
NM_001008344 Rosetta Predictions rat pricing
NM_144866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015827 predicted 396
2 SASI_Hs01_00015829 predicted 384
3 SASI_Hs01_00015830 predicted 956
4 SASI_Hs01_00015831 predicted 519
5 SASI_Hs01_00015832 predicted 357
6 SASI_Hs01_00015833 predicted 324
7 SASI_Hs01_00015834 predicted 343
8 SASI_Hs01_00015835 predicted 399
9 SASI_Hs01_00015836 predicted 1402
10 SASI_Hs02_00338210 predicted 512
11 SASI_Hs01_00015828 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032731 predicted 466
2 SASI_Rn01_00032732 predicted 1089
3 SASI_Rn01_00032733 predicted 327
4 SASI_Rn01_00032734 predicted 1137
5 SASI_Rn01_00032735 predicted 1327
6 SASI_Rn01_00032736 predicted 275
7 SASI_Rn01_00032737 predicted 444
8 SASI_Rn01_00032738 predicted 896
9 SASI_Rn01_00032740 predicted 363
10 SASI_Rn02_00199096 predicted 1053
11 SASI_Rn01_00032739 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174260 predicted 542
2 SASI_Mm01_00174262 predicted 421
3 SASI_Mm01_00174261 predicted 777
4 SASI_Mm01_00174263 predicted 977
5 SASI_Mm01_00174264 predicted 1235
6 SASI_Mm01_00174265 predicted 452
7 SASI_Mm01_00174267 predicted 997
8 SASI_Mm02_00340294 predicted 1342
9 SASI_Mm01_00174268 predicted 1312
10 SASI_Mm02_00340295 predicted 361
11 SASI_Mm01_00174266 predicted 304
12 SASI_Mm01_00174269 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144866
VALIDATED
ETF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation termination factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1572s1c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-734s1c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1335s1c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-404s1c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-301s1c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-783s21c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-350s21c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1384s21c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-453s21c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1621s21c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144866
VALIDATED
ETF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation termination factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1572s1c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-734s1c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1335s1c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-404s1c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-301s1c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-783s21c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-350s21c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1384s21c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-453s21c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1621s21c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144866
VALIDATED
ETF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation termination factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1572s1c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-734s1c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-1335s1c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-404s1c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144866.2-301s1c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-783s21c1
Sequence:CCGGCATAACTATGTTCGGAAAGTACTCGAGTACTTTCCGAACATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-350s21c1
Sequence:CCGGCGAGTTTGGAACTGCATCTAACTCGAGTTAGATGCAGTTCCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1384s21c1
Sequence:CCGGGATCACAGTTTGTGAAAGGATCTCGAGATCCTTTCACAAACTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-453s21c1
Sequence:CCGGCCTCCAAATGGTCTGGTTGTTCTCGAGAACAACCAGACCATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144866.3-1621s21c1
Sequence:CCGGCCGTGAGCATTGGATACTGAACTCGAGTTCAGTATCCAATGCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004730
VALIDATED
ETF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation termination factor 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-545s1c1
Sequence:CCGGCAGCACTACTTTCAGATGATACTCGAGTATCATCTGAAAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004730.1-2906s1c1
Sequence:CCGGGCTGTTCTTTACTGACTTGATCTCGAGATCAAGTCAGTAAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-727s1c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-355s1c1
Sequence:CCGGGCCATTACATCTGTACAACAACTCGAGTTGTTGTACAGATGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-1655s1c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004730.1-3261s1c1
Sequence:CCGGGCCATTGTAAATGGGTCTGATCTCGAGATCAGACCCATTTACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-293s1c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-264s1c1
Sequence:CCGGCCAGATTTCACGAGTGGCAAACTCGAGTTTGCCACTCGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1066s1c1
Sequence:CCGGGCTTTGGAAATGGGAGCTGTACTCGAGTACAGCTCCCATTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-957s1c1
Sequence:CCGGCCTCTCCAACGTGAAATTCATCTCGAGATGAATTTCACGTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1327s1c1
Sequence:CCGGGAAGGGTCTCAGTTTGTGAAACTCGAGTTTCACAAACTGAGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-642s1c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-1294s1c1
Sequence:CCGGGCTACGTTGGAAATTGTCACACTCGAGTGTGACAATTTCCAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004730.2-1685s21c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-757s21c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-672s21c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-323s21c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004730
VALIDATED
ETF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation termination factor 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-545s1c1
Sequence:CCGGCAGCACTACTTTCAGATGATACTCGAGTATCATCTGAAAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004730.1-2906s1c1
Sequence:CCGGGCTGTTCTTTACTGACTTGATCTCGAGATCAAGTCAGTAAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-727s1c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-355s1c1
Sequence:CCGGGCCATTACATCTGTACAACAACTCGAGTTGTTGTACAGATGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-1655s1c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004730.1-3261s1c1
Sequence:CCGGGCCATTGTAAATGGGTCTGATCTCGAGATCAGACCCATTTACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-293s1c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-264s1c1
Sequence:CCGGCCAGATTTCACGAGTGGCAAACTCGAGTTTGCCACTCGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1066s1c1
Sequence:CCGGGCTTTGGAAATGGGAGCTGTACTCGAGTACAGCTCCCATTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-957s1c1
Sequence:CCGGCCTCTCCAACGTGAAATTCATCTCGAGATGAATTTCACGTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1327s1c1
Sequence:CCGGGAAGGGTCTCAGTTTGTGAAACTCGAGTTTCACAAACTGAGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-642s1c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-1294s1c1
Sequence:CCGGGCTACGTTGGAAATTGTCACACTCGAGTGTGACAATTTCCAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004730.2-1685s21c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-757s21c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-672s21c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-323s21c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004730
VALIDATED
ETF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation termination factor 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-545s1c1
Sequence:CCGGCAGCACTACTTTCAGATGATACTCGAGTATCATCTGAAAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004730.1-2906s1c1
Sequence:CCGGGCTGTTCTTTACTGACTTGATCTCGAGATCAAGTCAGTAAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-727s1c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-355s1c1
Sequence:CCGGGCCATTACATCTGTACAACAACTCGAGTTGTTGTACAGATGTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-1655s1c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004730.1-3261s1c1
Sequence:CCGGGCCATTGTAAATGGGTCTGATCTCGAGATCAGACCCATTTACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004730.1-293s1c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-264s1c1
Sequence:CCGGCCAGATTTCACGAGTGGCAAACTCGAGTTTGCCACTCGTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1066s1c1
Sequence:CCGGGCTTTGGAAATGGGAGCTGTACTCGAGTACAGCTCCCATTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-957s1c1
Sequence:CCGGCCTCTCCAACGTGAAATTCATCTCGAGATGAATTTCACGTTGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-1327s1c1
Sequence:CCGGGAAGGGTCTCAGTTTGTGAAACTCGAGTTTCACAAACTGAGACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004730.1-642s1c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004730.1-1294s1c1
Sequence:CCGGGCTACGTTGGAAATTGTCACACTCGAGTGTGACAATTTCCAACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004730.2-1685s21c1
Sequence:CCGGGCCTACAACTAAGTTCCTAAACTCGAGTTTAGGAACTTAGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-757s21c1
Sequence:CCGGCGACATAACTATGTTCGGAAACTCGAGTTTCCGAACATAGTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-672s21c1
Sequence:CCGGGCACAAATTCACTGTGGATCTCTCGAGAGATCCACAGTGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004730.2-323s21c1
Sequence:CCGGCGGATGAGTTTGGAACTGCATCTCGAGATGCAGTTCCAAACTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks