EMAIL THIS PAGE TO A FRIEND

ETFB

electron-transfer-flavoprotein, beta polypeptide

79 Gene Product Result for
Synonyms: MADD
UniProtKB ID: P38117, B3KNY2, Q6IBH7, Q71RF6, Q9Y3S7
Gene ID:
Human(2109) Summary: This gene encodes electron-transfer-flavoprotein, beta polypeptide, which shuttles electrons between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The gene deficiencies have been implicated in type II glutaricaciduria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(110826) electron transferring flavoprotein, beta polypeptide
Rat(292845) electron-transfer-flavoprotein, beta polypeptide
Zebrafish(406271) electron-transfer-flavoprotein, beta polypeptide
cow(617210) electron-transfer-flavoprotein, beta polypeptide
domestic cat(101085254) electron-transfer-flavoprotein, beta polypeptide
dog(476400) electron-transfer-flavoprotein, beta polypeptide
sheep(101110082) electron-transfer-flavoprotein, beta polypeptide
naked mole-rat(101710064) electron-transfer-flavoprotein, beta polypeptide
domestic guinea pig(100715015) electron-transfer-flavoprotein, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101091 Anti-ETFB (156-170) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2501354 Anti-ETFB (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, mouse, rat, canine
ELISA, immunohistochemistry, western blot pricing
SAB2501353 Anti-ETFB antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human, canine
ELISA, immunohistochemistry, western blot pricing
SAB1405770 Anti-ETFB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV54442 Anti-ETFB antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, bovine, pig, horse, rat, mouse, rabbit
western blot pricing
HPA018910 Anti-ETFB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA018921 Anti-ETFB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 mouse, rat, human
immunohistochemistry, western blot pricing
HPA018923 Anti-ETFB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014763 Rosetta Predictions human pricing
NM_001985 Rosetta Predictions human pricing
NM_001004220 Rosetta Predictions rat pricing
NM_026695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049245 predicted 852
2 SASI_Hs01_00049247 predicted 882
3 SASI_Hs01_00049248 predicted 1063
4 SASI_Hs01_00049249 predicted 875
5 SASI_Hs01_00049250 predicted 1020
6 SASI_Hs01_00049251 predicted 852
7 SASI_Hs01_00049252 predicted 839
8 SASI_Hs01_00049253 predicted 867
9 SASI_Hs01_00049254 predicted 845
10 SASI_Hs02_00306561 predicted 1078
11 SASI_Hs01_00049246 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129106 predicted 466
2 SASI_Hs01_00129108 predicted 496
3 SASI_Hs01_00129109 predicted 671
4 SASI_Hs01_00129110 predicted 497
5 SASI_Hs01_00129111 predicted 631
6 SASI_Hs01_00129112 predicted 468
7 SASI_Hs01_00129113 predicted 454
8 SASI_Hs01_00129114 predicted 486
9 SASI_Hs01_00129115 predicted 452
10 SASI_Hs02_00332971 predicted 684
11 SASI_Hs01_00129107 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112569 predicted 399
2 SASI_Rn02_00198212 predicted 406
3 SASI_Rn01_00112570 predicted 546
4 SASI_Rn01_00112572 predicted 585
5 SASI_Rn01_00112573 predicted 396
6 SASI_Rn01_00112574 predicted 246
7 SASI_Rn01_00112575 predicted 461
8 SASI_Rn01_00112576 predicted 202
9 SASI_Rn01_00112577 predicted 561
10 SASI_Rn01_00112578 predicted 527
11 SASI_Rn01_00112571 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106996 predicted 378
2 SASI_Mm01_00106997 predicted 377
3 SASI_Mm01_00106999 predicted 373
4 SASI_Mm01_00107000 predicted 364
5 SASI_Mm01_00107001 predicted 552
6 SASI_Mm01_00107002 predicted 503
7 SASI_Mm01_00107003 predicted 438
8 SASI_Mm01_00107005 predicted 572
9 SASI_Mm02_00330738 predicted 405
10 SASI_Mm02_00330739 predicted 561
11 SASI_Mm01_00106998 predicted 589
12 SASI_Mm01_00107004 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001985
VALIDATED
ETFB MISSION shRNA Bacterial Glycerol Stock
electron-transfer-flavoprotein, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-75s1c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-183s1c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-401s1c1
Sequence:CCGGAGGCCATCGATGATGACTGTACTCGAGTACAGTCATCATCGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-123s1c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001985.1-612s1c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-188s21c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-140s21c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-248s21c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-677s21c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001985
VALIDATED
ETFB MISSION shRNA shRNA Plasmid DNA
electron-transfer-flavoprotein, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-75s1c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-183s1c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-401s1c1
Sequence:CCGGAGGCCATCGATGATGACTGTACTCGAGTACAGTCATCATCGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-123s1c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001985.1-612s1c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-188s21c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-140s21c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-248s21c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-677s21c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001985
VALIDATED
ETFB MISSION shRNA Lentiviral Transduction Particles
electron-transfer-flavoprotein, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-75s1c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-183s1c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-401s1c1
Sequence:CCGGAGGCCATCGATGATGACTGTACTCGAGTACAGTCATCATCGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001985.1-123s1c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001985.1-612s1c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-188s21c1
Sequence:CCGGTGGTGTGAAGCACTCCATGAACTCGAGTTCATGGAGTGCTTCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-140s21c1
Sequence:CCGGCGCCGTGAAGATCCGAGTGAACTCGAGTTCACTCGGATCTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-248s21c1
Sequence:CCGGCAAGGAGAAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001985.2-677s21c1
Sequence:CCGGGCCCAACATCATGAAAGCCAACTCGAGTTGGCTTTCATGATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026695
VALIDATED
ETFB MISSION shRNA Bacterial Glycerol Stock
electron-transfer-flavoprotein, beta polypeptide
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026695.2-395s1c1
Sequence:CCGGCTGTAACCAGACAGGTCAGATCTCGAGATCTGACCTGTCTGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-607s21c1
Sequence:CCGGCCAAGAAGAAGAAGATTGAAGCTCGAGCTTCAATCTTCTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-550s21c1
Sequence:CCGGCTGCTGACCTAAGGCTCAATGCTCGAGCATTGAGCCTTAGGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-381s21c1
Sequence:CCGGGCTATTGATGATGACTGTAACCTCGAGGTTACAGTCATCATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-89s21c1
Sequence:CCGGAGTGGTCACTGATGGTGTGAACTCGAGTTCACACCATCAGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-53s21c1
Sequence:CCGGCGCTGTGAAGATTCGGGTAAACTCGAGTTTACCCGAATCTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026695
VALIDATED
ETFB MISSION shRNA shRNA Plasmid DNA
electron-transfer-flavoprotein, beta polypeptide
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026695.2-395s1c1
Sequence:CCGGCTGTAACCAGACAGGTCAGATCTCGAGATCTGACCTGTCTGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-607s21c1
Sequence:CCGGCCAAGAAGAAGAAGATTGAAGCTCGAGCTTCAATCTTCTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-550s21c1
Sequence:CCGGCTGCTGACCTAAGGCTCAATGCTCGAGCATTGAGCCTTAGGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-381s21c1
Sequence:CCGGGCTATTGATGATGACTGTAACCTCGAGGTTACAGTCATCATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-89s21c1
Sequence:CCGGAGTGGTCACTGATGGTGTGAACTCGAGTTCACACCATCAGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-53s21c1
Sequence:CCGGCGCTGTGAAGATTCGGGTAAACTCGAGTTTACCCGAATCTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026695
VALIDATED
ETFB MISSION shRNA Lentiviral Transduction Particles
electron-transfer-flavoprotein, beta polypeptide
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026695.2-395s1c1
Sequence:CCGGCTGTAACCAGACAGGTCAGATCTCGAGATCTGACCTGTCTGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-607s21c1
Sequence:CCGGCCAAGAAGAAGAAGATTGAAGCTCGAGCTTCAATCTTCTTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-550s21c1
Sequence:CCGGCTGCTGACCTAAGGCTCAATGCTCGAGCATTGAGCCTTAGGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-381s21c1
Sequence:CCGGGCTATTGATGATGACTGTAACCTCGAGGTTACAGTCATCATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-89s21c1
Sequence:CCGGAGTGGTCACTGATGGTGTGAACTCGAGTTCACACCATCAGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026695.2-53s21c1
Sequence:CCGGCGCTGTGAAGATTCGGGTAAACTCGAGTTTACCCGAATCTTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks