EMAIL THIS PAGE TO A FRIEND

ETFDH

electron-transferring-flavoprotein dehydrogenase

52 Gene Product Result for
Synonyms: ETFQO MADD
UniProtKB ID: Q16134, Q7Z347
Gene ID:
Human(2110) Summary: Electron-transferring-flavoprotein dehydrogenase in the inner mitochondrial membrane accepts electrons from electron-transfer flavoprotein which is located in the mitochondrial matrix and reduces ubiquinone in the mitochondrial membrane. The protein is synthesized as a 67-kDa precursor which is targeted to mitochondria and processed in a single step to a 64-kDa mature form located in the mitochondrial membrane. Deficiency in electron-transferring-flavoprotein dehydrogenase have been demonstrated in some patients with type II glutaricacidemia. [provided by RefSeq, Jul 2008]
Mouse(66841) electron transferring flavoprotein, dehydrogenase
Rat(295143) electron-transferring-flavoprotein dehydrogenase
Zebrafish(447859) electron-transferring-flavoprotein dehydrogenase
cow(768074) electron-transferring-flavoprotein dehydrogenase
Horse(100061849) electron-transferring-flavoprotein dehydrogenase
domestic cat(101085458) electron-transferring-flavoprotein dehydrogenase
dog(475480) electron-transferring-flavoprotein dehydrogenase
chicken(428724) electron-transferring-flavoprotein dehydrogenase
domestic guinea pig(100729397) electron-transferring-flavoprotein dehydrogenase
naked mole-rat(101716036) electron-transferring-flavoprotein dehydrogenase
sheep(101106714) electron-transferring-flavoprotein dehydrogenase
Domestic Rabbit(100340346) electron-transferring-flavoprotein dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004453 Rosetta Predictions human pricing
NM_198742 Rosetta Predictions rat pricing
NM_025794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092717 predicted 739
2 SASI_Hs01_00092718 predicted 1075
3 SASI_Hs01_00092719 predicted 1114
4 SASI_Hs02_00337634 predicted 786
5 SASI_Hs02_00337635 predicted 854
6 SASI_Hs01_00092720 predicted 973
7 SASI_Hs01_00092721 predicted 646
8 SASI_Hs01_00092723 predicted 703
9 SASI_Hs02_00337636 predicted 841
10 SASI_Hs01_00092724 predicted 1315
11 SASI_Hs01_00092722 predicted 588
12 SASI_Hs01_00092725 predicted 619
13 SASI_Hs01_00092726 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096001 predicted 287
2 SASI_Rn01_00096002 predicted 575
3 SASI_Rn01_00096003 predicted 1812
4 SASI_Rn01_00096004 predicted 411
5 SASI_Rn01_00096005 predicted 1112
6 SASI_Rn01_00096006 predicted 1913
7 SASI_Rn01_00096007 predicted 627
8 SASI_Rn01_00096008 predicted 1878
9 SASI_Rn01_00096009 predicted 1799
10 SASI_Rn02_00269966 predicted 1504
11 SASI_Rn01_00096000 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127980 predicted 1653
2 SASI_Mm01_00127981 predicted 624
3 SASI_Mm01_00127982 predicted 1795
4 SASI_Mm01_00127983 predicted 572
5 SASI_Mm02_00329038 predicted 847
6 SASI_Mm01_00127984 predicted 1553
7 SASI_Mm01_00127985 predicted 282
8 SASI_Mm01_00127986 predicted 1773
9 SASI_Mm01_00127987 predicted 984
10 SASI_Mm01_00127988 predicted 654
11 SASI_Mm01_00127979 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004453
VALIDATED
ETFDH MISSION shRNA Bacterial Glycerol Stock
electron-transferring-flavoprotein dehydrogenase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1005s21c1
Sequence:CCGGGGTGCACCAAAGGCAACATTTCTCGAGAAATGTTGCCTTTGGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1248s21c1
Sequence:CCGGGGATCTTTCCTCTATCATTTGCTCGAGCAAATGATAGAGGAAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-613s1c1
Sequence:CCGGCCAATGAATAATCATGGCAATCTCGAGATTGCCATGATTATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-1625s1c1
Sequence:CCGGGCACACCTATTGAGTATCCAACTCGAGTTGGATACTCAATAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-237s1c1
Sequence:CCGGGCCTCGAATTACTACCCATTACTCGAGTAATGGGTAGTAATTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-415s1c1
Sequence:CCGGCGTGTGTGTCTAGTGGAGAAACTCGAGTTTCTCCACTAGACACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-763s1c1
Sequence:CCGGGCCACTAACGATGTAGGGATACTCGAGTATCCCTACATCGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004453
VALIDATED
ETFDH MISSION shRNA shRNA Plasmid DNA
electron-transferring-flavoprotein dehydrogenase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1005s21c1
Sequence:CCGGGGTGCACCAAAGGCAACATTTCTCGAGAAATGTTGCCTTTGGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1248s21c1
Sequence:CCGGGGATCTTTCCTCTATCATTTGCTCGAGCAAATGATAGAGGAAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-613s1c1
Sequence:CCGGCCAATGAATAATCATGGCAATCTCGAGATTGCCATGATTATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-1625s1c1
Sequence:CCGGGCACACCTATTGAGTATCCAACTCGAGTTGGATACTCAATAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-237s1c1
Sequence:CCGGGCCTCGAATTACTACCCATTACTCGAGTAATGGGTAGTAATTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-415s1c1
Sequence:CCGGCGTGTGTGTCTAGTGGAGAAACTCGAGTTTCTCCACTAGACACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-763s1c1
Sequence:CCGGGCCACTAACGATGTAGGGATACTCGAGTATCCCTACATCGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004453
VALIDATED
ETFDH MISSION shRNA Lentiviral Transduction Particles
electron-transferring-flavoprotein dehydrogenase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1005s21c1
Sequence:CCGGGGTGCACCAAAGGCAACATTTCTCGAGAAATGTTGCCTTTGGTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004453.2-1248s21c1
Sequence:CCGGGGATCTTTCCTCTATCATTTGCTCGAGCAAATGATAGAGGAAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-613s1c1
Sequence:CCGGCCAATGAATAATCATGGCAATCTCGAGATTGCCATGATTATTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-1625s1c1
Sequence:CCGGGCACACCTATTGAGTATCCAACTCGAGTTGGATACTCAATAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-237s1c1
Sequence:CCGGGCCTCGAATTACTACCCATTACTCGAGTAATGGGTAGTAATTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004453.1-415s1c1
Sequence:CCGGCGTGTGTGTCTAGTGGAGAAACTCGAGTTTCTCCACTAGACACACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004453.1-763s1c1
Sequence:CCGGGCCACTAACGATGTAGGGATACTCGAGTATCCCTACATCGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025794
VALIDATED
ETFDH MISSION shRNA Bacterial Glycerol Stock
electron-transferring-flavoprotein dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1999s21c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-659s21c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-200s21c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-809s21c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1083s21c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-659s1c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-809s1c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1999s1c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1083s1c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-200s1c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025794
VALIDATED
ETFDH MISSION shRNA shRNA Plasmid DNA
electron-transferring-flavoprotein dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1999s21c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-659s21c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-200s21c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-809s21c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1083s21c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-659s1c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-809s1c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1999s1c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1083s1c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-200s1c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025794
VALIDATED
ETFDH MISSION shRNA Lentiviral Transduction Particles
electron-transferring-flavoprotein dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1999s21c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-659s21c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-200s21c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-809s21c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025794.1-1083s21c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-659s1c1
Sequence:CCGGCCGATGAACAATCATGGCAATCTCGAGATTGCCATGATTGTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-809s1c1
Sequence:CCGGGCCACTAATGATGTAGGCATACTCGAGTATGCCTACATCATTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1999s1c1
Sequence:CCGGGCCTGCTTACAATGGCATGTACTCGAGTACATGCCATTGTAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-1083s1c1
Sequence:CCGGGCTCTTTCCTTTACCACTTAACTCGAGTTAAGTGGTAAAGGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025794.1-200s1c1
Sequence:CCGGCCTGCGTATCACTGGTTTCATCTCGAGATGAAACCAGTGATACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks