EMAIL THIS PAGE TO A FRIEND

ETHE1

ethylmalonic encephalopathy 1

56 Gene Product Result for
Synonyms: HSCO YF13H12
UniProtKB ID: O95571, Q96HR0, Q9H001
Gene ID:
Human(23474) Summary: This gene encodes a sulfur dioxygenase that localizes within the mitochondrial matrix. The enzyme functions in sulfide catabolism. Mutations in this gene result in ethylmalonic encephalopathy.[provided by RefSeq, May 2009]
Mouse(66071) ethylmalonic encephalopathy 1
Rat(292710) ethylmalonic encephalopathy 1
Zebrafish(405865) ethylmalonic encephalopathy 1
cow(509150) ethylmalonic encephalopathy 1
domestic cat(101092565) ethylmalonic encephalopathy 1
dog(612416) ethylmalonic encephalopathy 1
chicken(426450) ethylmalonic encephalopathy 1
sheep(101108154) ethylmalonic encephalopathy 1
naked mole-rat(101700567) ethylmalonic encephalopathy 1
domestic guinea pig(100726914) ethylmalonic encephalopathy 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014297 Rosetta Predictions human pricing
NM_001106234 Rosetta Predictions rat pricing
NM_023154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166058 predicted 647
2 SASI_Hs01_00166059 predicted 632
3 SASI_Hs01_00166060 predicted 512
4 SASI_Hs01_00166061 predicted 715
5 SASI_Hs01_00166062 predicted 484
6 SASI_Hs01_00166063 predicted 583
7 SASI_Hs01_00166064 predicted 609
8 SASI_Hs01_00166065 predicted 404
9 SASI_Hs01_00166066 predicted 392
10 SASI_Hs02_00345386 predicted 570
11 SASI_Hs01_00166067 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216958 predicted 555
2 SASI_Rn02_00216959 predicted 602
3 SASI_Rn02_00216960 predicted 460
4 SASI_Rn02_00216961 predicted 466
5 SASI_Rn02_00216962 predicted 689
6 SASI_Rn02_00216963 predicted 697
7 SASI_Rn02_00216964 predicted 527
8 SASI_Rn02_00216965 predicted 575
9 SASI_Rn02_00216966 predicted 497
10 SASI_Rn02_00216967 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197944 predicted 1202
2 SASI_Mm01_00197946 predicted 965
3 SASI_Mm02_00326878 predicted 926
4 SASI_Mm02_00326879 predicted 980
5 SASI_Mm01_00197947 predicted 1188
6 SASI_Mm01_00197948 predicted 985
7 SASI_Mm01_00197949 predicted 1116
8 SASI_Mm01_00197950 predicted 911
9 SASI_Mm01_00197951 predicted 1153
10 SASI_Mm01_00197952 predicted 1079
11 SASI_Mm01_00197945 predicted 1117
12 SASI_Mm01_00197953 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023154
VALIDATED
ETHE1 MISSION shRNA Bacterial Glycerol Stock
ethylmalonic encephalopathy 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1345s1c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1124s1c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1272s1c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-779s1c1
Sequence:CCGGCAAGCTGTTGTACGCTGTGAACTCGAGTTCACAGCGTACAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023154.3-662s1c1
Sequence:CCGGCAAGAGCTGCACCTATACCTACTCGAGTAGGTATAGGTGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1345s21c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1124s21c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1272s21c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-745s21c1
Sequence:CCGGATCGGGATGCTCAGTTGATTACTCGAGTAATCAACTGAGCATCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023154
VALIDATED
ETHE1 MISSION shRNA shRNA Plasmid DNA
ethylmalonic encephalopathy 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1345s1c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1124s1c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1272s1c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-779s1c1
Sequence:CCGGCAAGCTGTTGTACGCTGTGAACTCGAGTTCACAGCGTACAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023154.3-662s1c1
Sequence:CCGGCAAGAGCTGCACCTATACCTACTCGAGTAGGTATAGGTGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1345s21c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1124s21c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1272s21c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-745s21c1
Sequence:CCGGATCGGGATGCTCAGTTGATTACTCGAGTAATCAACTGAGCATCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023154
VALIDATED
ETHE1 MISSION shRNA Lentiviral Transduction Particles
ethylmalonic encephalopathy 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1345s1c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1124s1c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-1272s1c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023154.3-779s1c1
Sequence:CCGGCAAGCTGTTGTACGCTGTGAACTCGAGTTCACAGCGTACAACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023154.3-662s1c1
Sequence:CCGGCAAGAGCTGCACCTATACCTACTCGAGTAGGTATAGGTGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1345s21c1
Sequence:CCGGCCAGCTGCTCACATCCGTTATCTCGAGATAACGGATGTGAGCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1124s21c1
Sequence:CCGGTCCAGGCAACTGTCTAATCTACTCGAGTAGATTAGACAGTTGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-1272s21c1
Sequence:CCGGCAGCAGATAGACATTGCTGTTCTCGAGAACAGCAATGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023154.3-745s21c1
Sequence:CCGGATCGGGATGCTCAGTTGATTACTCGAGTAATCAACTGAGCATCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014297
VALIDATED
ETHE1 MISSION shRNA Bacterial Glycerol Stock
ethylmalonic encephalopathy 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-395s1c1
Sequence:CCGGGCTGACTTACACATTGAGGATCTCGAGATCCTCAATGTGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-646s1c1
Sequence:CCGGTGCTCACGATTACCATGGGTTCTCGAGAACCCATGGTAATCGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-757s1c1
Sequence:CCGGCTTGCCTAAACCTCAGCAGATCTCGAGATCTGCTGAGGTTTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-622s1c1
Sequence:CCGGTCCAGGAGACTGTCTGATCTACTCGAGTAGATCAGACAGTCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-770s1c1
Sequence:CCGGCAGCAGATAGACTTTGCTGTTCTCGAGAACAGCAAAGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-365s21c1
Sequence:CCGGTCTGTCATCTCCCGCCTTAGTCTCGAGACTAAGGCGGGAGATGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-719s21c1
Sequence:CCGGAGCTGTGAGGAGTTTGTCAAACTCGAGTTTGACAAACTCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-485s21c1
Sequence:CCGGGTCACCTTCGTCCTGAATGACCTCGAGGTCATTCAGGACGAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014297
VALIDATED
ETHE1 MISSION shRNA shRNA Plasmid DNA
ethylmalonic encephalopathy 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-395s1c1
Sequence:CCGGGCTGACTTACACATTGAGGATCTCGAGATCCTCAATGTGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-646s1c1
Sequence:CCGGTGCTCACGATTACCATGGGTTCTCGAGAACCCATGGTAATCGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-757s1c1
Sequence:CCGGCTTGCCTAAACCTCAGCAGATCTCGAGATCTGCTGAGGTTTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-622s1c1
Sequence:CCGGTCCAGGAGACTGTCTGATCTACTCGAGTAGATCAGACAGTCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-770s1c1
Sequence:CCGGCAGCAGATAGACTTTGCTGTTCTCGAGAACAGCAAAGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-365s21c1
Sequence:CCGGTCTGTCATCTCCCGCCTTAGTCTCGAGACTAAGGCGGGAGATGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-719s21c1
Sequence:CCGGAGCTGTGAGGAGTTTGTCAAACTCGAGTTTGACAAACTCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-485s21c1
Sequence:CCGGGTCACCTTCGTCCTGAATGACCTCGAGGTCATTCAGGACGAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014297
VALIDATED
ETHE1 MISSION shRNA Lentiviral Transduction Particles
ethylmalonic encephalopathy 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-395s1c1
Sequence:CCGGGCTGACTTACACATTGAGGATCTCGAGATCCTCAATGTGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-646s1c1
Sequence:CCGGTGCTCACGATTACCATGGGTTCTCGAGAACCCATGGTAATCGTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-757s1c1
Sequence:CCGGCTTGCCTAAACCTCAGCAGATCTCGAGATCTGCTGAGGTTTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014297.3-622s1c1
Sequence:CCGGTCCAGGAGACTGTCTGATCTACTCGAGTAGATCAGACAGTCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014297.3-770s1c1
Sequence:CCGGCAGCAGATAGACTTTGCTGTTCTCGAGAACAGCAAAGTCTATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-365s21c1
Sequence:CCGGTCTGTCATCTCCCGCCTTAGTCTCGAGACTAAGGCGGGAGATGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-719s21c1
Sequence:CCGGAGCTGTGAGGAGTTTGTCAAACTCGAGTTTGACAAACTCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014297.3-485s21c1
Sequence:CCGGGTCACCTTCGTCCTGAATGACCTCGAGGTCATTCAGGACGAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks