EMAIL THIS PAGE TO A FRIEND

ETNK1

ethanolamine kinase 1

270 Gene Product Result for
Synonyms: EKI EKI 1 EKI1 Nbla10396
UniProtKB ID: Q9HBU6, G5E969
Gene ID:
Human(55500) Summary: This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(75320) ethanolamine kinase 1
Rat(312828) ethanolamine kinase 1
sheep(101114860) ethanolamine kinase 1
domestic guinea pig(100721611) ethanolamine kinase 1
naked mole-rat(101723803) ethanolamine kinase 1
Zebrafish(565971) ethanolamine kinase 1
chicken(418196) ethanolamine kinase 1
dog(486637) ethanolamine kinase 1
domestic cat(101093696) ethanolamine kinase 1
cow(540705) ethanolamine kinase 1
Horse(100068424) ethanolamine kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039481 Rosetta Predictions human pricing
NM_018638 Rosetta Predictions human pricing
NM_001107894 Rosetta Predictions rat pricing
XM_908334 Rosetta Predictions mouse pricing
XM_979562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145713 predicted 865
2 SASI_Hs01_00145714 predicted 510
3 SASI_Hs01_00145715 predicted 528
4 SASI_Hs01_00145716 predicted 767
5 SASI_Hs01_00145717 predicted 521
6 SASI_Hs01_00145718 predicted 604
7 SASI_Hs01_00145719 predicted 549
8 SASI_Hs01_00145721 predicted 656
9 SASI_Hs01_00145722 predicted 673
10 SASI_Hs02_00308526 predicted 504
11 SASI_Hs01_00145720 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352133 predicted 1223
2 SASI_Hs01_00175734 predicted 929
3 SASI_Hs01_00175735 predicted 525
4 SASI_Hs01_00175736 predicted 1282
5 SASI_Hs02_00352134 predicted 1256
6 SASI_Hs01_00175737 predicted 1018
7 SASI_Hs01_00175738 predicted 937
8 SASI_Hs01_00175739 predicted 608
9 SASI_Hs01_00175743 predicted 779
10 SASI_Hs02_00352135 predicted 1149
11 SASI_Hs01_00175740 predicted 1297
12 SASI_Hs01_00175741 predicted 540
13 SASI_Hs01_00175742 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233325 predicted 1404
2 SASI_Rn02_00233326 predicted 975
3 SASI_Rn02_00233327 predicted 1036
4 SASI_Rn02_00233328 predicted 1102
5 SASI_Rn02_00233329 predicted 557
6 SASI_Rn02_00233330 predicted 745
7 SASI_Rn02_00233331 predicted 963
8 SASI_Rn02_00233332 predicted 889
9 SASI_Rn02_00233333 predicted 384
10 SASI_Rn02_00233334 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263239 predicted 860
2 SASI_Mm01_00263240 predicted 1376
3 SASI_Mm01_00263241 predicted 1421
4 SASI_Mm01_00263242 predicted 1351
5 SASI_Mm01_00263243 predicted 1481
6 SASI_Mm01_00263245 predicted 1308
7 SASI_Mm01_00263246 predicted 855
8 SASI_Mm01_00263247 predicted 1406
9 SASI_Mm01_00263248 predicted 1350
10 SASI_Mm02_00434001 predicted 1273
11 SASI_Mm01_00263244 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447003 predicted 854
2 SASI_Mm02_00447004 predicted 1372
3 SASI_Mm02_00447005 predicted 1420
4 SASI_Mm02_00447006 predicted 1355
5 SASI_Mm02_00447007 predicted 1484
6 SASI_Mm02_00447008 predicted 1303
7 SASI_Mm02_00447009 predicted 859
8 SASI_Mm02_00447010 predicted 1412
9 SASI_Mm02_00447011 predicted 1351
10 SASI_Mm02_00447012 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029250
VALIDATED
ETNK1 MISSION shRNA Bacterial Glycerol Stock
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-1627s21c1
Sequence:CCGGTTGACATGACTGACTACTTTGCTCGAGCAAAGTAGTCAGTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-911s21c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-1106s21c1
Sequence:CCGGTGAAGCTTACAAGGAGTATAACTCGAGTTATACTCCTTGTAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-697s21c1
Sequence:CCGGATGCTATTCATGCGCACAATGCTCGAGCATTGTGCGCATGAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-953s21c1
Sequence:CCGGTGACGTACAGTTCATTGATTACTCGAGTAATCAATGAACTGTACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029250
VALIDATED
ETNK1 MISSION shRNA shRNA Plasmid DNA
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-1627s21c1
Sequence:CCGGTTGACATGACTGACTACTTTGCTCGAGCAAAGTAGTCAGTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-911s21c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-1106s21c1
Sequence:CCGGTGAAGCTTACAAGGAGTATAACTCGAGTTATACTCCTTGTAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-697s21c1
Sequence:CCGGATGCTATTCATGCGCACAATGCTCGAGCATTGTGCGCATGAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-953s21c1
Sequence:CCGGTGACGTACAGTTCATTGATTACTCGAGTAATCAATGAACTGTACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029250
VALIDATED
ETNK1 MISSION shRNA Lentiviral Transduction Particles
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-1627s21c1
Sequence:CCGGTTGACATGACTGACTACTTTGCTCGAGCAAAGTAGTCAGTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-911s21c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-1106s21c1
Sequence:CCGGTGAAGCTTACAAGGAGTATAACTCGAGTTATACTCCTTGTAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029250.2-697s21c1
Sequence:CCGGATGCTATTCATGCGCACAATGCTCGAGCATTGTGCGCATGAATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029250.2-953s21c1
Sequence:CCGGTGACGTACAGTTCATTGATTACTCGAGTAATCAATGAACTGTACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018638
VALIDATED
ETNK1 MISSION shRNA Bacterial Glycerol Stock
ethanolamine kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-647s21c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-1504s21c1
Sequence:CCGGTATGCCTCTAAACAATCAAATCTCGAGATTTGATTGTTTAGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-1137s21c1
Sequence:CCGGCTTACCTTGAAGCCTACAAAGCTCGAGCTTTGTAGGCTTCAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-540s21c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-938s21c1
Sequence:CCGGCTTTGCCATAATGACCTATTGCTCGAGCAATAGGTCATTATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018638.4-819s1c1
Sequence:CCGGGATTTGCAGATGAAGACATTACTCGAGTAATGTCTTCATCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018638.4-2509s1c1
Sequence:CCGGGCATTGATCTTGTACACTTAACTCGAGTTAAGTGTACAAGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-361s1c1
Sequence:CCGGCCAATTACATCCACGTCCCTCCTCGAGGAGGGACGTGGATGTAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-394s1c1
Sequence:CCGGAGGTGCCCAAGCTGAACGTCACTCGAGTGACGTTCAGCTTGGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-607s1c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-714s1c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-581s1c1
Sequence:CCGGCCTGGTGAGAATTTATGGCAACTCGAGTTGCCATAAATTCTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018638
VALIDATED
ETNK1 MISSION shRNA shRNA Plasmid DNA
ethanolamine kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-647s21c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-1504s21c1
Sequence:CCGGTATGCCTCTAAACAATCAAATCTCGAGATTTGATTGTTTAGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-1137s21c1
Sequence:CCGGCTTACCTTGAAGCCTACAAAGCTCGAGCTTTGTAGGCTTCAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-540s21c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-938s21c1
Sequence:CCGGCTTTGCCATAATGACCTATTGCTCGAGCAATAGGTCATTATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018638.4-819s1c1
Sequence:CCGGGATTTGCAGATGAAGACATTACTCGAGTAATGTCTTCATCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018638.4-2509s1c1
Sequence:CCGGGCATTGATCTTGTACACTTAACTCGAGTTAAGTGTACAAGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-361s1c1
Sequence:CCGGCCAATTACATCCACGTCCCTCCTCGAGGAGGGACGTGGATGTAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-394s1c1
Sequence:CCGGAGGTGCCCAAGCTGAACGTCACTCGAGTGACGTTCAGCTTGGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-607s1c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-714s1c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-581s1c1
Sequence:CCGGCCTGGTGAGAATTTATGGCAACTCGAGTTGCCATAAATTCTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018638
VALIDATED
ETNK1 MISSION shRNA Lentiviral Transduction Particles
ethanolamine kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-647s21c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018638.4-1504s21c1
Sequence:CCGGTATGCCTCTAAACAATCAAATCTCGAGATTTGATTGTTTAGAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-1137s21c1
Sequence:CCGGCTTACCTTGAAGCCTACAAAGCTCGAGCTTTGTAGGCTTCAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-540s21c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018638.4-938s21c1
Sequence:CCGGCTTTGCCATAATGACCTATTGCTCGAGCAATAGGTCATTATGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018638.4-819s1c1
Sequence:CCGGGATTTGCAGATGAAGACATTACTCGAGTAATGTCTTCATCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018638.4-2509s1c1
Sequence:CCGGGCATTGATCTTGTACACTTAACTCGAGTTAAGTGTACAAGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-361s1c1
Sequence:CCGGCCAATTACATCCACGTCCCTCCTCGAGGAGGGACGTGGATGTAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-394s1c1
Sequence:CCGGAGGTGCCCAAGCTGAACGTCACTCGAGTGACGTTCAGCTTGGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-607s1c1
Sequence:CCGGCTGAGTTATTAGTCGATCGAGCTCGAGCTCGATCGACTAATAACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018638.x-714s1c1
Sequence:CCGGGAATTTATACAAGGAGAAGCACTCGAGTGCTTCTCCTTGTATAAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018638.x-581s1c1
Sequence:CCGGCCTGGTGAGAATTTATGGCAACTCGAGTTGCCATAAATTCTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284250
VALIDATED
ETNK1 MISSION shRNA Bacterial Glycerol Stock
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-1004s1c1
Sequence:CCGGCCTGGCATATGATATTGGAAACTCGAGTTTCCAATATCATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-920s1c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-500s1c1
Sequence:CCGGCGGCAACAAGACTGAACTGTTCTCGAGAACAGTTCAGTCTTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-735s1c1
Sequence:CCGGCCCAAATCTAACCTATGGCTACTCGAGTAGCCATAGGTTAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-784s1c1
Sequence:CCGGCCACCGGATTTGCTGATGAAACTCGAGTTTCATCAGCAAATCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284250
VALIDATED
ETNK1 MISSION shRNA shRNA Plasmid DNA
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-1004s1c1
Sequence:CCGGCCTGGCATATGATATTGGAAACTCGAGTTTCCAATATCATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-920s1c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-500s1c1
Sequence:CCGGCGGCAACAAGACTGAACTGTTCTCGAGAACAGTTCAGTCTTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-735s1c1
Sequence:CCGGCCCAAATCTAACCTATGGCTACTCGAGTAGCCATAGGTTAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-784s1c1
Sequence:CCGGCCACCGGATTTGCTGATGAAACTCGAGTTTCATCAGCAAATCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284250
VALIDATED
ETNK1 MISSION shRNA Lentiviral Transduction Particles
ethanolamine kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-1004s1c1
Sequence:CCGGCCTGGCATATGATATTGGAAACTCGAGTTTCCAATATCATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-920s1c1
Sequence:CCGGCGACCTGTTGTGTAAGAATATCTCGAGATATTCTTACACAACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_284250.2-500s1c1
Sequence:CCGGCGGCAACAAGACTGAACTGTTCTCGAGAACAGTTCAGTCTTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-735s1c1
Sequence:CCGGCCCAAATCTAACCTATGGCTACTCGAGTAGCCATAGGTTAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284250.2-784s1c1
Sequence:CCGGCCACCGGATTTGCTGATGAAACTCGAGTTTCATCAGCAAATCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks