EMAIL THIS PAGE TO A FRIEND

ETNK2

ethanolamine kinase 2

72 Gene Product Result for
Synonyms: EKI2 HMFT1716
UniProtKB ID: Q9NVF9, B7Z7K1, Q5SXX5, Q68CK3, Q96G05
Gene ID:
Human(55224) Summary: The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. [provided by RefSeq, Jul 2008]
Mouse(214253) ethanolamine kinase 2
Rat(360843) ethanolamine kinase 2
Zebrafish(555330) ethanolamine kinase 2
chicken(426690) ethanolamine kinase 2
domestic cat(101081436) ethanolamine kinase 2
cow(533229) ethanolamine kinase 2
dog(478935) ethanolamine kinase 2
naked mole-rat(101697056) ethanolamine kinase 2
domestic guinea pig(100724316) ethanolamine kinase 2
sheep(101107456) ethanolamine kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018208 Rosetta Predictions human pricing
NM_001108343 Rosetta Predictions rat pricing
NM_175443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351509 predicted 1651
2 SASI_Hs01_00019234 predicted 1423
3 SASI_Hs02_00351510 predicted 1411
4 SASI_Hs01_00019235 predicted 836
5 SASI_Hs02_00351511 predicted 1960
6 SASI_Hs02_00351512 predicted 1421
7 SASI_Hs01_00019237 predicted 913
8 SASI_Hs02_00351513 predicted 839
9 SASI_Hs01_00019238 predicted 923
10 SASI_Hs01_00019239 predicted 1378
11 SASI_Hs01_00019232 predicted 861
12 SASI_Hs01_00019233 predicted 802
13 SASI_Hs01_00019236 predicted 976
14 SASI_Hs01_00019240 predicted 584
15 SASI_Hs01_00019241 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237729 predicted 609
2 SASI_Rn02_00237730 predicted 395
3 SASI_Rn02_00237731 predicted 231
4 SASI_Rn02_00237732 predicted 259
5 SASI_Rn02_00237733 predicted 221
6 SASI_Rn02_00237734 predicted 419
7 SASI_Rn02_00237735 predicted 216
8 SASI_Rn02_00237736 predicted 403
9 SASI_Rn02_00237737 predicted 200
10 SASI_Rn02_00237738 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131442 predicted 470
2 SASI_Mm02_00346339 predicted 1002
3 SASI_Mm01_00131444 predicted 779
4 SASI_Mm01_00131446 predicted 815
5 SASI_Mm02_00346340 predicted 1287
6 SASI_Mm02_00346341 predicted 1186
7 SASI_Mm02_00346342 predicted 1108
8 SASI_Mm02_00346343 predicted 1225
9 SASI_Mm02_00346344 predicted 1265
10 SASI_Mm02_00346345 predicted 927
11 SASI_Mm01_00131443 predicted 229
12 SASI_Mm01_00131445 predicted 400
13 SASI_Mm01_00131447 predicted 302
14 SASI_Mm01_00131448 predicted 796
15 SASI_Mm01_00131449 predicted 590
16 SASI_Mm01_00131450 predicted 876
17 SASI_Mm01_00131451 predicted 960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175443
ETNK2 MISSION shRNA Bacterial Glycerol Stock
ethanolamine kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-245s1c1
Sequence:CCGGCGGCATCACCAACAAGCTATTCTCGAGAATAGCTTGTTGGTGATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-500s1c1
Sequence:CCGGCGCCTTAGAAATGGCTAAGATCTCGAGATCTTAGCCATTTCTAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-396s1c1
Sequence:CCGGCCCAAACTCTACTGTACCTTTCTCGAGAAAGGTACAGTAGAGTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-702s1c1
Sequence:CCGGGTGGTGTTCTGTCACAATGATCTCGAGATCATTGTGACAGAACACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-719s1c1
Sequence:CCGGTGATCTACTCTGCAAGAATATCTCGAGATATTCTTGCAGAGTAGATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1194s21c1
Sequence:CCGGATTCGCTCTGGCATCTCATTTCTCGAGAAATGAGATGCCAGAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1233s21c1
Sequence:CCGGACTCATACAGAACCAGTATTCCTCGAGGAATACTGGTTCTGTATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1104s21c1
Sequence:CCGGGGTGCAGTGGCTGCGTTATTACTCGAGTAATAACGCAGCCACTGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175443
ETNK2 MISSION shRNA shRNA Plasmid DNA
ethanolamine kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-245s1c1
Sequence:CCGGCGGCATCACCAACAAGCTATTCTCGAGAATAGCTTGTTGGTGATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-500s1c1
Sequence:CCGGCGCCTTAGAAATGGCTAAGATCTCGAGATCTTAGCCATTTCTAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-396s1c1
Sequence:CCGGCCCAAACTCTACTGTACCTTTCTCGAGAAAGGTACAGTAGAGTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-702s1c1
Sequence:CCGGGTGGTGTTCTGTCACAATGATCTCGAGATCATTGTGACAGAACACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-719s1c1
Sequence:CCGGTGATCTACTCTGCAAGAATATCTCGAGATATTCTTGCAGAGTAGATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1194s21c1
Sequence:CCGGATTCGCTCTGGCATCTCATTTCTCGAGAAATGAGATGCCAGAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1233s21c1
Sequence:CCGGACTCATACAGAACCAGTATTCCTCGAGGAATACTGGTTCTGTATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1104s21c1
Sequence:CCGGGGTGCAGTGGCTGCGTTATTACTCGAGTAATAACGCAGCCACTGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175443
ETNK2 MISSION shRNA Lentiviral Transduction Particles
ethanolamine kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-245s1c1
Sequence:CCGGCGGCATCACCAACAAGCTATTCTCGAGAATAGCTTGTTGGTGATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-500s1c1
Sequence:CCGGCGCCTTAGAAATGGCTAAGATCTCGAGATCTTAGCCATTTCTAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-396s1c1
Sequence:CCGGCCCAAACTCTACTGTACCTTTCTCGAGAAAGGTACAGTAGAGTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-702s1c1
Sequence:CCGGGTGGTGTTCTGTCACAATGATCTCGAGATCATTGTGACAGAACACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175443.2-719s1c1
Sequence:CCGGTGATCTACTCTGCAAGAATATCTCGAGATATTCTTGCAGAGTAGATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1194s21c1
Sequence:CCGGATTCGCTCTGGCATCTCATTTCTCGAGAAATGAGATGCCAGAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1233s21c1
Sequence:CCGGACTCATACAGAACCAGTATTCCTCGAGGAATACTGGTTCTGTATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175443.5-1104s21c1
Sequence:CCGGGGTGCAGTGGCTGCGTTATTACTCGAGTAATAACGCAGCCACTGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018208
VALIDATED
ETNK2 MISSION shRNA Bacterial Glycerol Stock
ethanolamine kinase 2
Human
22 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c1
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-567s1c1
Sequence:CCGGCGCCTTAGAAATGGCAAAGATCTCGAGATCTTTGCCATTTCTAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-630s1c1
Sequence:CCGGCTGGCACAAGATGCACAATTACTCGAGTAATTGTGCATCTTGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c1
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-1095s1c1
Sequence:CCGGCCAGTGCTGTAGAGTCGGAAACTCGAGTTTCCGACTCTACAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-280s1c1
Sequence:CCGGCCCGAGCAAGTTCGGACCAAGCTCGAGCTTGGTCCGAACTTGCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-911s1c1
Sequence:CCGGGCGTGAATGAGGTGGATTACTCTCGAGAGTAATCCACCTCATTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-656s1c1
Sequence:CCGGCGCTTGTGAAGAACGAGATCACTCGAGTGATCTCGTTCTTCACAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-1790s1c1
Sequence:CCGGCACATGGATGTACCTATCTTGCTCGAGCAAGATAGGTACATCCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-2269s1c1
Sequence:CCGGCCATCAGAAAGGTGCTGACTACTCGAGTAGTCAGCACCTTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-1029s1c1
Sequence:CCGGCTACGTGCAAGTCAACAAGTTCTCGAGAACTTGTTGACTTGCACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-642s1c1
Sequence:CCGGGCACAATTATTTCACGCTTGTCTCGAGACAAGCGTGAAATAATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c2
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c2
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1530s21c1
Sequence:GTACCGGCCTGTTCTCCAGAGCTCAATTCTCGAGAATTGAGCTCTGGAGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1316s21c1
Sequence:GTACCGGACGTGCAAGTCAACAAGTTTGCTCGAGCAAACTTGTTGACTTGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018208.2-1079s21c1
Sequence:GTACCGGTCTGCAAGAATATCATCTATGCTCGAGCATAGATGATATTCTTGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1385s21c1
Sequence:CCGGAGTACTCCACCATCGACTTTGCTCGAGCAAAGTCGATGGTGGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-2451s21c1
Sequence:CCGGTCAGAAAGGTGCTGACTAAACCTCGAGGTTTAGTCAGCACCTTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1184s21c1
Sequence:CCGGATGAGTTTGCAGGCGTGAATGCTCGAGCATTCACGCCTGCAAACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1115s21c1
Sequence:CCGGACGTGCGGTTCATTGACTATGCTCGAGCATAGTCAATGAACCGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-916s21c1
Sequence:CCGGTGGCACAAGATGCACAATTATCTCGAGATAATTGTGCATCTTGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018208
VALIDATED
ETNK2 MISSION shRNA shRNA Plasmid DNA
ethanolamine kinase 2
Human
22 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c1
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-567s1c1
Sequence:CCGGCGCCTTAGAAATGGCAAAGATCTCGAGATCTTTGCCATTTCTAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-630s1c1
Sequence:CCGGCTGGCACAAGATGCACAATTACTCGAGTAATTGTGCATCTTGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c1
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-1095s1c1
Sequence:CCGGCCAGTGCTGTAGAGTCGGAAACTCGAGTTTCCGACTCTACAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-280s1c1
Sequence:CCGGCCCGAGCAAGTTCGGACCAAGCTCGAGCTTGGTCCGAACTTGCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-911s1c1
Sequence:CCGGGCGTGAATGAGGTGGATTACTCTCGAGAGTAATCCACCTCATTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-656s1c1
Sequence:CCGGCGCTTGTGAAGAACGAGATCACTCGAGTGATCTCGTTCTTCACAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-1790s1c1
Sequence:CCGGCACATGGATGTACCTATCTTGCTCGAGCAAGATAGGTACATCCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-2269s1c1
Sequence:CCGGCCATCAGAAAGGTGCTGACTACTCGAGTAGTCAGCACCTTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-1029s1c1
Sequence:CCGGCTACGTGCAAGTCAACAAGTTCTCGAGAACTTGTTGACTTGCACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-642s1c1
Sequence:CCGGGCACAATTATTTCACGCTTGTCTCGAGACAAGCGTGAAATAATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c2
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c2
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1530s21c1
Sequence:GTACCGGCCTGTTCTCCAGAGCTCAATTCTCGAGAATTGAGCTCTGGAGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1316s21c1
Sequence:GTACCGGACGTGCAAGTCAACAAGTTTGCTCGAGCAAACTTGTTGACTTGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018208.2-1079s21c1
Sequence:GTACCGGTCTGCAAGAATATCATCTATGCTCGAGCATAGATGATATTCTTGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1385s21c1
Sequence:CCGGAGTACTCCACCATCGACTTTGCTCGAGCAAAGTCGATGGTGGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-2451s21c1
Sequence:CCGGTCAGAAAGGTGCTGACTAAACCTCGAGGTTTAGTCAGCACCTTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1184s21c1
Sequence:CCGGATGAGTTTGCAGGCGTGAATGCTCGAGCATTCACGCCTGCAAACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1115s21c1
Sequence:CCGGACGTGCGGTTCATTGACTATGCTCGAGCATAGTCAATGAACCGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-916s21c1
Sequence:CCGGTGGCACAAGATGCACAATTATCTCGAGATAATTGTGCATCTTGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018208
VALIDATED
ETNK2 MISSION shRNA Lentiviral Transduction Particles
ethanolamine kinase 2
Human
22 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c1
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-567s1c1
Sequence:CCGGCGCCTTAGAAATGGCAAAGATCTCGAGATCTTTGCCATTTCTAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-630s1c1
Sequence:CCGGCTGGCACAAGATGCACAATTACTCGAGTAATTGTGCATCTTGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c1
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-1095s1c1
Sequence:CCGGCCAGTGCTGTAGAGTCGGAAACTCGAGTTTCCGACTCTACAGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-280s1c1
Sequence:CCGGCCCGAGCAAGTTCGGACCAAGCTCGAGCTTGGTCCGAACTTGCTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-911s1c1
Sequence:CCGGGCGTGAATGAGGTGGATTACTCTCGAGAGTAATCCACCTCATTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-656s1c1
Sequence:CCGGCGCTTGTGAAGAACGAGATCACTCGAGTGATCTCGTTCTTCACAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-1790s1c1
Sequence:CCGGCACATGGATGTACCTATCTTGCTCGAGCAAGATAGGTACATCCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018208.1-2269s1c1
Sequence:CCGGCCATCAGAAAGGTGCTGACTACTCGAGTAGTCAGCACCTTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018208.1-1029s1c1
Sequence:CCGGCTACGTGCAAGTCAACAAGTTCTCGAGAACTTGTTGACTTGCACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-642s1c1
Sequence:CCGGGCACAATTATTTCACGCTTGTCTCGAGACAAGCGTGAAATAATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-268s1c2
Sequence:CCGGCCGCATTGGAAACCCGAGCAACTCGAGTTGCTCGGGTTTCCAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018208.1-834s1c2
Sequence:CCGGGCGGTTCATTGACTATGAATACTCGAGTATTCATAGTCAATGAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1530s21c1
Sequence:GTACCGGCCTGTTCTCCAGAGCTCAATTCTCGAGAATTGAGCTCTGGAGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1316s21c1
Sequence:GTACCGGACGTGCAAGTCAACAAGTTTGCTCGAGCAAACTTGTTGACTTGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018208.2-1079s21c1
Sequence:GTACCGGTCTGCAAGAATATCATCTATGCTCGAGCATAGATGATATTCTTGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1385s21c1
Sequence:CCGGAGTACTCCACCATCGACTTTGCTCGAGCAAAGTCGATGGTGGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-2451s21c1
Sequence:CCGGTCAGAAAGGTGCTGACTAAACCTCGAGGTTTAGTCAGCACCTTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1184s21c1
Sequence:CCGGATGAGTTTGCAGGCGTGAATGCTCGAGCATTCACGCCTGCAAACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-1115s21c1
Sequence:CCGGACGTGCGGTTCATTGACTATGCTCGAGCATAGTCAATGAACCGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018208.2-916s21c1
Sequence:CCGGTGGCACAAGATGCACAATTATCTCGAGATAATTGTGCATCTTGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)