EMAIL THIS PAGE TO A FRIEND

ETNPPL

ethanolamine-phosphate phospho-lyase

52 Gene Product Result for
Synonyms: AGXT2L1
UniProtKB ID: Q8TBG4, B7Z1Y0, E9PBY0, Q9H174
Gene ID:
Mouse(71760) ethanolamine phosphate phospholyase
Rat(687071) ethanolamine-phosphate phospho-lyase
domestic guinea pig(100735915) ethanolamine-phosphate phospho-lyase
naked mole-rat(101708633) ethanolamine-phosphate phospho-lyase
Zebrafish(393421) ethanolamine-phosphate phospho-lyase
cow(515186) alanine-glyoxylate aminotransferase 2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038651 MISSION® esiRNA esiRNA human AGXT2L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031279 Rosetta Predictions human pricing
XM_001076965 Rosetta Predictions rat pricing
NM_027907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155950 predicted 1390
2 SASI_Hs01_00155952 predicted 1745
3 SASI_Hs02_00358695 predicted 1717
4 SASI_Hs01_00155953 predicted 1433
5 SASI_Hs01_00155954 predicted 366
6 SASI_Hs01_00155956 predicted 274
7 SASI_Hs01_00155957 predicted 837
8 SASI_Hs01_00155958 predicted 1734
9 SASI_Hs01_00155959 predicted 454
10 SASI_Hs02_00358696 predicted 1200
11 SASI_Hs01_00155951 predicted 1615
12 SASI_Hs01_00155955 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355232 predicted 424
2 SASI_Rn02_00355233 predicted 623
3 SASI_Rn02_00355234 predicted 213
4 SASI_Rn02_00355235 predicted 436
5 SASI_Rn02_00355236 predicted 211
6 SASI_Rn02_00355237 predicted 555
7 SASI_Rn02_00355238 predicted 236
8 SASI_Rn02_00355239 predicted 607
9 SASI_Rn02_00355240 predicted 522
10 SASI_Rn02_00355241 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070483 predicted 1676
2 SASI_Mm02_00332882 predicted 913
3 SASI_Mm01_00070485 predicted 1475
4 SASI_Mm01_00070486 predicted 803
5 SASI_Mm02_00332883 predicted 1676
6 SASI_Mm01_00070487 predicted 1607
7 SASI_Mm02_00332884 predicted 740
8 SASI_Mm01_00070489 predicted 885
9 SASI_Mm01_00070490 predicted 551
10 SASI_Mm01_00070491 predicted 306
11 SASI_Mm01_00070484 predicted 339
12 SASI_Mm01_00070488 predicted 1611
13 SASI_Mm01_00070492 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031279
VALIDATED
ETNPPL MISSION shRNA Bacterial Glycerol Stock
ethanolamine-phosphate phospho-lyase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-433s21c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-607s21c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1187s21c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1513s21c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1161s1c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-407s1c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-581s1c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1487s1c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031279
VALIDATED
ETNPPL MISSION shRNA shRNA Plasmid DNA
ethanolamine-phosphate phospho-lyase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-433s21c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-607s21c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1187s21c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1513s21c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1161s1c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-407s1c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-581s1c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1487s1c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031279
VALIDATED
ETNPPL MISSION shRNA Lentiviral Transduction Particles
ethanolamine-phosphate phospho-lyase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-433s21c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-607s21c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1187s21c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031279.3-1513s21c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1161s1c1
Sequence:CCGGGCCAAGAGAGTAGGGAATTATCTCGAGATAATTCCCTACTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-407s1c1
Sequence:CCGGCCACGACAACATTGTTGAGTACTCGAGTACTCAACAATGTTGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-581s1c1
Sequence:CCGGCCTATCATCCTTAATTGAGATCTCGAGATCTCAATTAAGGATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031279.2-1487s1c1
Sequence:CCGGCGAAAGTGTGACCTCTGAGAACTCGAGTTCTCAGAGGTCACACTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027907
ETNPPL MISSION shRNA Bacterial Glycerol Stock
ethanolamine-phosphate phospho-lyase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027907.1-1899s1c1
Sequence:CCGGGCCATGTTTGAAATTAGAGAACTCGAGTTCTCTAATTTCAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-329s1c1
Sequence:CCGGCGCGAAACAGATGGAATTACTCTCGAGAGTAATTCCATCTGTTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-372s1c1
Sequence:CCGGCACGACAACATCATTGAGTTTCTCGAGAAACTCAATGATGTTGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-1494s1c1
Sequence:CCGGCCTAAGGAAATACAAGTGGAACTCGAGTTCCACTTGTATTTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-327s1c1
Sequence:CCGGGCCGCGAAACAGATGGAATTACTCGAGTAATTCCATCTGTTTCGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027907
ETNPPL MISSION shRNA shRNA Plasmid DNA
ethanolamine-phosphate phospho-lyase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027907.1-1899s1c1
Sequence:CCGGGCCATGTTTGAAATTAGAGAACTCGAGTTCTCTAATTTCAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-329s1c1
Sequence:CCGGCGCGAAACAGATGGAATTACTCTCGAGAGTAATTCCATCTGTTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-372s1c1
Sequence:CCGGCACGACAACATCATTGAGTTTCTCGAGAAACTCAATGATGTTGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-1494s1c1
Sequence:CCGGCCTAAGGAAATACAAGTGGAACTCGAGTTCCACTTGTATTTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-327s1c1
Sequence:CCGGGCCGCGAAACAGATGGAATTACTCGAGTAATTCCATCTGTTTCGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027907
ETNPPL MISSION shRNA Lentiviral Transduction Particles
ethanolamine-phosphate phospho-lyase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027907.1-1899s1c1
Sequence:CCGGGCCATGTTTGAAATTAGAGAACTCGAGTTCTCTAATTTCAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-329s1c1
Sequence:CCGGCGCGAAACAGATGGAATTACTCTCGAGAGTAATTCCATCTGTTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-372s1c1
Sequence:CCGGCACGACAACATCATTGAGTTTCTCGAGAAACTCAATGATGTTGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-1494s1c1
Sequence:CCGGCCTAAGGAAATACAAGTGGAACTCGAGTTCCACTTGTATTTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027907.1-327s1c1
Sequence:CCGGGCCGCGAAACAGATGGAATTACTCGAGTAATTCCATCTGTTTCGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)