EMAIL THIS PAGE TO A FRIEND

ETS1

v-ets avian erythroblastosis virus E26 oncogene homolog 1

291 Gene Product Result for
Synonyms: ETS-1 EWSR2
UniProtKB ID: P14921, A9UL17, F5GYX9, Q14278, Q16080, Q6N087
Gene ID:
Human(2113) Summary: This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Mouse(23871) E26 avian leukemia oncogene 1, 5' domain
Rat(24356) v-ets avian erythroblastosis virus E26 oncogene homolog 1
chicken(396235) v-ets erythroblastosis virus E26 oncogene
Horse(100064559) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
cow(540313) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
dog(489287) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
Goat(100860919) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
Domestic Rabbit(100009373) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
sheep(101114986) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
naked mole-rat(101717727) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
domestic guinea pig(100724487) v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E3408 Anti-ETS1 (131-145) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E3533 Anti-ETS1 (301-315) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV100604 Anti-ETS1 antibody produced in rabbit IgG fraction of antiserum goat, mouse, rabbit, rat, bovine, human, horse, guinea pig, canine, zebrafish
immunohistochemistry, western blot pricing
SAB1410348 Anti-ETS1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
HPA063230 Anti-ETS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4500815 Anti-ETS1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503912 Anti-phospho-ETS1 (pThr38) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301235 Anti-phospho-ETS1 (pThr38) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB5300301 Monoclonal Anti-ETS1 antibody produced in mouse clone 8A8, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300302 Monoclonal Anti-ETS1 antibody produced in mouse clone 10D2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1402768 Monoclonal Anti-ETS1, (C-terminal) antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084801 MISSION® esiRNA esiRNA human ETS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005238 Rosetta Predictions human pricing
NM_012555 Rosetta Predictions rat pricing
NM_001038642 Rosetta Predictions mouse pricing
NM_011808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173246 predicted 673
2 SASI_Hs01_00173247 predicted 679
3 SASI_Hs01_00173248 predicted 377
4 SASI_Hs01_00173249 predicted 678
5 SASI_Hs01_00173250 predicted 926
6 SASI_Hs01_00173251 predicted 539
7 SASI_Hs01_00173252 predicted 1409
8 SASI_Hs01_00173253 predicted 665
9 SASI_Hs01_00173254 predicted 1641
10 SASI_Hs01_00173255 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107171 predicted 686
2 SASI_Rn01_00107172 predicted 729
3 SASI_Rn01_00107173 predicted 526
4 SASI_Rn01_00107174 predicted 953
5 SASI_Rn02_00259665 predicted 962
6 SASI_Rn01_00107175 predicted 1420
7 SASI_Rn01_00107177 predicted 740
8 SASI_Rn01_00107178 predicted 1046
9 SASI_Rn01_00107179 predicted 938
10 SASI_Rn01_00107180 predicted 1661
11 SASI_Rn01_00107176 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161376 predicted 430
2 SASI_Mm01_00161377 predicted 479
3 SASI_Mm01_00161378 predicted 839
4 SASI_Mm01_00161379 predicted 797
5 SASI_Mm01_00161380 predicted 746
6 SASI_Mm01_00161381 predicted 489
7 SASI_Mm01_00161382 predicted 1465
8 SASI_Mm01_00161383 predicted 736
9 SASI_Mm01_00161384 predicted 359
10 SASI_Mm01_00161385 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158626 predicted 429
2 SASI_Mm01_00158627 predicted 480
3 SASI_Mm01_00158628 predicted 842
4 SASI_Mm01_00158629 predicted 790
5 SASI_Mm01_00158630 predicted 746
6 SASI_Mm01_00158631 predicted 485
7 SASI_Mm01_00158632 predicted 1723
8 SASI_Mm01_00158633 predicted 739
9 SASI_Mm01_00158634 predicted 367
10 SASI_Mm01_00158635 predicted 1699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005238
VALIDATED
ETS1 MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005238.2-3566s1c1
Sequence:CCGGCCCAGAATTATCAGGAACATACTCGAGTATGTTCCTGATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005238.2-351s1c1
Sequence:CCGGCCGGATATGGAATGTGCAGATCTCGAGATCTGCACATTCCATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-1296s1c1
Sequence:CCGGCTGGAATTACTCACTGATAAACTCGAGTTTATCAGTGAGTAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-591s1c1
Sequence:CCGGGCCCTGGGTAAAGACTGCTTTCTCGAGAAAGCAGTCTTTACCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005238.2-2357s21c1
Sequence:CCGGCCAAATTCATGGGACTTATATCTCGAGATATAAGTCCCATGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-725s21c1
Sequence:CCGGATCCCGCTATACCTCGGATTACTCGAGTAATCCGAGGTATAGCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-680s21c1
Sequence:CCGGTGTGAAACCATATCAAGTTAACTCGAGTTAACTTGATATGGTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-364s21c1
Sequence:CCGGGTGCAGATGTCCCACTATTAACTCGAGTTAATAGTGGGACATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005238
VALIDATED
ETS1 MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005238.2-3566s1c1
Sequence:CCGGCCCAGAATTATCAGGAACATACTCGAGTATGTTCCTGATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005238.2-351s1c1
Sequence:CCGGCCGGATATGGAATGTGCAGATCTCGAGATCTGCACATTCCATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-1296s1c1
Sequence:CCGGCTGGAATTACTCACTGATAAACTCGAGTTTATCAGTGAGTAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-591s1c1
Sequence:CCGGGCCCTGGGTAAAGACTGCTTTCTCGAGAAAGCAGTCTTTACCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005238.2-2357s21c1
Sequence:CCGGCCAAATTCATGGGACTTATATCTCGAGATATAAGTCCCATGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-725s21c1
Sequence:CCGGATCCCGCTATACCTCGGATTACTCGAGTAATCCGAGGTATAGCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-680s21c1
Sequence:CCGGTGTGAAACCATATCAAGTTAACTCGAGTTAACTTGATATGGTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-364s21c1
Sequence:CCGGGTGCAGATGTCCCACTATTAACTCGAGTTAATAGTGGGACATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005238
VALIDATED
ETS1 MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005238.2-3566s1c1
Sequence:CCGGCCCAGAATTATCAGGAACATACTCGAGTATGTTCCTGATAATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005238.2-351s1c1
Sequence:CCGGCCGGATATGGAATGTGCAGATCTCGAGATCTGCACATTCCATATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-1296s1c1
Sequence:CCGGCTGGAATTACTCACTGATAAACTCGAGTTTATCAGTGAGTAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_005238.2-591s1c1
Sequence:CCGGGCCCTGGGTAAAGACTGCTTTCTCGAGAAAGCAGTCTTTACCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005238.2-2357s21c1
Sequence:CCGGCCAAATTCATGGGACTTATATCTCGAGATATAAGTCCCATGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-725s21c1
Sequence:CCGGATCCCGCTATACCTCGGATTACTCGAGTAATCCGAGGTATAGCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-680s21c1
Sequence:CCGGTGTGAAACCATATCAAGTTAACTCGAGTTAACTTGATATGGTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005238.2-364s21c1
Sequence:CCGGGTGCAGATGTCCCACTATTAACTCGAGTTAATAGTGGGACATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011808
VALIDATED
ETS1 MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-242s1c1
Sequence:CCGGGCTACTTTAGTGGTTTCACAACTCGAGTTGTGAAACCACTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011808.1-940s1c1
Sequence:CCGGGACAGCTTTGACTACGAGGATCTCGAGATCCTCGTAGTCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-471s1c1
Sequence:CCGGGCATCTAGAGATCCTGCAGAACTCGAGTTCTGCAGGATCTCTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-747s1c1
Sequence:CCGGGCAGACAGACTACTTTCGGATCTCGAGATCCGAAAGTAGTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-1266s1c1
Sequence:CCGGGCTTCGCTACTATTATGACAACTCGAGTTGTCATAATAGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011808.2-1732s21c1
Sequence:CCGGTGTTGGTTGGACTCTTCATTTCTCGAGAAATGAAGAGTCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1513s21c1
Sequence:CCGGCGTGGCCTTCGCTACTATTATCTCGAGATAATAGTAGCGAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-752s21c1
Sequence:CCGGTGAAACCATATCAGGTTAATGCTCGAGCATTAACCTGATATGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1196s21c1
Sequence:CCGGGCTTCGACTACGAGGATTATCCTCGAGGATAATCCTCGTAGTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-995s21c1
Sequence:CCGGCCTTGCAGACAGACTACTTTGCTCGAGCAAAGTAGTCTGTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1017s21c1
Sequence:CCGGCATCAAGCAAGAGGTGTTAACCTCGAGGTTAACACCTCTTGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011808
VALIDATED
ETS1 MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-242s1c1
Sequence:CCGGGCTACTTTAGTGGTTTCACAACTCGAGTTGTGAAACCACTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011808.1-940s1c1
Sequence:CCGGGACAGCTTTGACTACGAGGATCTCGAGATCCTCGTAGTCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-471s1c1
Sequence:CCGGGCATCTAGAGATCCTGCAGAACTCGAGTTCTGCAGGATCTCTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-747s1c1
Sequence:CCGGGCAGACAGACTACTTTCGGATCTCGAGATCCGAAAGTAGTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-1266s1c1
Sequence:CCGGGCTTCGCTACTATTATGACAACTCGAGTTGTCATAATAGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011808.2-1732s21c1
Sequence:CCGGTGTTGGTTGGACTCTTCATTTCTCGAGAAATGAAGAGTCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1513s21c1
Sequence:CCGGCGTGGCCTTCGCTACTATTATCTCGAGATAATAGTAGCGAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-752s21c1
Sequence:CCGGTGAAACCATATCAGGTTAATGCTCGAGCATTAACCTGATATGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1196s21c1
Sequence:CCGGGCTTCGACTACGAGGATTATCCTCGAGGATAATCCTCGTAGTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-995s21c1
Sequence:CCGGCCTTGCAGACAGACTACTTTGCTCGAGCAAAGTAGTCTGTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1017s21c1
Sequence:CCGGCATCAAGCAAGAGGTGTTAACCTCGAGGTTAACACCTCTTGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011808
VALIDATED
ETS1 MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-242s1c1
Sequence:CCGGGCTACTTTAGTGGTTTCACAACTCGAGTTGTGAAACCACTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011808.1-940s1c1
Sequence:CCGGGACAGCTTTGACTACGAGGATCTCGAGATCCTCGTAGTCAAAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-471s1c1
Sequence:CCGGGCATCTAGAGATCCTGCAGAACTCGAGTTCTGCAGGATCTCTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-747s1c1
Sequence:CCGGGCAGACAGACTACTTTCGGATCTCGAGATCCGAAAGTAGTCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011808.1-1266s1c1
Sequence:CCGGGCTTCGCTACTATTATGACAACTCGAGTTGTCATAATAGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011808.2-1732s21c1
Sequence:CCGGTGTTGGTTGGACTCTTCATTTCTCGAGAAATGAAGAGTCCAACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1513s21c1
Sequence:CCGGCGTGGCCTTCGCTACTATTATCTCGAGATAATAGTAGCGAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-752s21c1
Sequence:CCGGTGAAACCATATCAGGTTAATGCTCGAGCATTAACCTGATATGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1196s21c1
Sequence:CCGGGCTTCGACTACGAGGATTATCCTCGAGGATAATCCTCGTAGTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-995s21c1
Sequence:CCGGCCTTGCAGACAGACTACTTTGCTCGAGCAAAGTAGTCTGTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011808.2-1017s21c1
Sequence:CCGGCATCAAGCAAGAGGTGTTAACCTCGAGGTTAACACCTCTTGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks