EMAIL THIS PAGE TO A FRIEND

ETS2

v-ets avian erythroblastosis virus E26 oncogene homolog 2

131 Gene Product Result for
Synonyms: ETS2IT1
UniProtKB ID: P15036, A6NM68, D3DSH6, Q53Y89
Gene ID:
Human(2114) Summary: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(23872) E26 avian leukemia oncogene 2, 3' domain
Rat(304063) v-ets avian erythroblastosis virus E26 oncogene homolog 2
Zebrafish(326672) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
cow(281148) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
domestic cat(101080565) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
dog(487761) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
chicken(396250) v-ets erythroblastosis virus E26 oncogene homolog 2
domestic guinea pig(100713442) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
naked mole-rat(101715881) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
sheep(443026) v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005239 Rosetta Predictions human pricing
NM_001107107 Rosetta Predictions rat pricing
NM_011809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130872 predicted 1328
2 SASI_Hs01_00130873 predicted 587
3 SASI_Hs01_00130874 predicted 1272
4 SASI_Hs01_00130875 predicted 419
5 SASI_Hs01_00130876 predicted 647
6 SASI_Hs01_00130877 predicted 1162
7 SASI_Hs01_00130878 predicted 1416
8 SASI_Hs01_00130879 predicted 194
9 SASI_Hs01_00130880 predicted 1179
10 SASI_Hs02_00339244 predicted 604
11 SASI_Hs01_00130871 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225566 predicted 3297
2 SASI_Rn02_00225567 predicted 3339
3 SASI_Rn02_00225568 predicted 3373
4 SASI_Rn02_00225569 predicted 3376
5 SASI_Rn02_00225570 predicted 3345
6 SASI_Rn02_00225571 predicted 3319
7 SASI_Rn02_00225572 predicted 3344
8 SASI_Rn02_00225573 predicted 3338
9 SASI_Rn02_00225574 predicted 3328
10 SASI_Rn02_00225575 predicted 3348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117749 predicted 721
2 SASI_Mm01_00117750 predicted 383
3 SASI_Mm01_00117751 predicted 382
4 SASI_Mm01_00117752 predicted 1382
5 SASI_Mm01_00117753 predicted 754
6 SASI_Mm02_00321495 predicted 1414
7 SASI_Mm01_00117754 predicted 1138
8 SASI_Mm01_00117755 predicted 898
9 SASI_Mm01_00117756 predicted 677
10 SASI_Mm01_00117757 predicted 1378
11 SASI_Mm01_00117758 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005239
ETS2 MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005239.4-1223s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATACTCGAGTATAACTGGTTTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005239.4-2092s21c1
Sequence:CCGGGAATCCCTTAACAGTTGTATTCTCGAGAATACAACTGTTAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-650s1c1
Sequence:CCGGCCTGACTTTGTGGGTGACATTCTCGAGAATGTCACCCACAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-425s1c1
Sequence:CCGGGCTGTGATGAGTCAAGCCTTACTCGAGTAAGGCTTGACTCATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005239.3-2244s1c1
Sequence:CCGGGCCGACTAAGAGAAGTTGTAACTCGAGTTACAACTTCTCTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-1175s1c1
Sequence:CCGGCCAACCATGTCTTTCAAGGATCTCGAGATCCTTGAAAGACATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-385s1c1
Sequence:CCGGCGCCAACTGTGAATTGCCTTTCTCGAGAAAGGCAATTCACAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005239
ETS2 MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005239.4-1223s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATACTCGAGTATAACTGGTTTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005239.4-2092s21c1
Sequence:CCGGGAATCCCTTAACAGTTGTATTCTCGAGAATACAACTGTTAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-650s1c1
Sequence:CCGGCCTGACTTTGTGGGTGACATTCTCGAGAATGTCACCCACAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-425s1c1
Sequence:CCGGGCTGTGATGAGTCAAGCCTTACTCGAGTAAGGCTTGACTCATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005239.3-2244s1c1
Sequence:CCGGGCCGACTAAGAGAAGTTGTAACTCGAGTTACAACTTCTCTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-1175s1c1
Sequence:CCGGCCAACCATGTCTTTCAAGGATCTCGAGATCCTTGAAAGACATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-385s1c1
Sequence:CCGGCGCCAACTGTGAATTGCCTTTCTCGAGAAAGGCAATTCACAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005239
ETS2 MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005239.4-1223s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATACTCGAGTATAACTGGTTTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005239.4-2092s21c1
Sequence:CCGGGAATCCCTTAACAGTTGTATTCTCGAGAATACAACTGTTAAGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-650s1c1
Sequence:CCGGCCTGACTTTGTGGGTGACATTCTCGAGAATGTCACCCACAAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-425s1c1
Sequence:CCGGGCTGTGATGAGTCAAGCCTTACTCGAGTAAGGCTTGACTCATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005239.3-2244s1c1
Sequence:CCGGGCCGACTAAGAGAAGTTGTAACTCGAGTTACAACTTCTCTTAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-1175s1c1
Sequence:CCGGCCAACCATGTCTTTCAAGGATCTCGAGATCCTTGAAAGACATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005239.3-385s1c1
Sequence:CCGGCGCCAACTGTGAATTGCCTTTCTCGAGAAAGGCAATTCACAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011809
VALIDATED
ETS2 MISSION shRNA Bacterial Glycerol Stock
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-888s21c1
Sequence:GTACCGGCAACACCGTCAATGTCAATTACTCGAGTAATTGACATTGACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-1183s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATTCTCGAGAATAACTGGTTTGCCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-3074s21c1
Sequence:CCGGCATTGATAAAGAGCCGTTATACTCGAGTATAACGGCTCTTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-644s21c1
Sequence:CCGGATCTAGAGCAGATGATCAAAGCTCGAGCTTTGATCATCTGCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011809.3-1994s21c1
Sequence:CCGGTTGCCTCCAGGAGTAGCAAATCTCGAGATTTGCTACTCCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011809.3-597s21c1
Sequence:CCGGACGAGTTCAGCCTGGTGAATGCTCGAGCATTCACCAGGCTGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-390s21c1
Sequence:CCGGAGTGATGAGCCAAGCCTTAAACTCGAGTTTAAGGCTTGGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-721s1c1
Sequence:CCGGCCTCAGTGGATCAACAGCAATCTCGAGATTGCTGTTGATCCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-893s1c1
Sequence:CCGGCCGTCAATGTCAATTACTGTTCTCGAGAACAGTAATTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-1466s1c1
Sequence:CCGGGCTACGTGTACCGTTTCGTATCTCGAGATACGAAACGGTACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-238s1c1
Sequence:CCGGCCAGCCTTTGACACCTTCGATCTCGAGATCGAAGGTGTCAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-951s1c1
Sequence:CCGGGCTCAACAACAATTCTGGAAACTCGAGTTTCCAGAATTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011809
VALIDATED
ETS2 MISSION shRNA shRNA Plasmid DNA
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-888s21c1
Sequence:GTACCGGCAACACCGTCAATGTCAATTACTCGAGTAATTGACATTGACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-1183s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATTCTCGAGAATAACTGGTTTGCCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-3074s21c1
Sequence:CCGGCATTGATAAAGAGCCGTTATACTCGAGTATAACGGCTCTTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-644s21c1
Sequence:CCGGATCTAGAGCAGATGATCAAAGCTCGAGCTTTGATCATCTGCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011809.3-1994s21c1
Sequence:CCGGTTGCCTCCAGGAGTAGCAAATCTCGAGATTTGCTACTCCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011809.3-597s21c1
Sequence:CCGGACGAGTTCAGCCTGGTGAATGCTCGAGCATTCACCAGGCTGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-390s21c1
Sequence:CCGGAGTGATGAGCCAAGCCTTAAACTCGAGTTTAAGGCTTGGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-721s1c1
Sequence:CCGGCCTCAGTGGATCAACAGCAATCTCGAGATTGCTGTTGATCCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-893s1c1
Sequence:CCGGCCGTCAATGTCAATTACTGTTCTCGAGAACAGTAATTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-1466s1c1
Sequence:CCGGGCTACGTGTACCGTTTCGTATCTCGAGATACGAAACGGTACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-238s1c1
Sequence:CCGGCCAGCCTTTGACACCTTCGATCTCGAGATCGAAGGTGTCAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-951s1c1
Sequence:CCGGGCTCAACAACAATTCTGGAAACTCGAGTTTCCAGAATTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011809
VALIDATED
ETS2 MISSION shRNA Lentiviral Transduction Particles
v-ets avian erythroblastosis virus E26 oncogene homolog 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-888s21c1
Sequence:GTACCGGCAACACCGTCAATGTCAATTACTCGAGTAATTGACATTGACGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-1183s21c1
Sequence:CCGGGAGCAAGGCAAACCAGTTATTCTCGAGAATAACTGGTTTGCCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-3074s21c1
Sequence:CCGGCATTGATAAAGAGCCGTTATACTCGAGTATAACGGCTCTTTATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-644s21c1
Sequence:CCGGATCTAGAGCAGATGATCAAAGCTCGAGCTTTGATCATCTGCTCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011809.3-1994s21c1
Sequence:CCGGTTGCCTCCAGGAGTAGCAAATCTCGAGATTTGCTACTCCTGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011809.3-597s21c1
Sequence:CCGGACGAGTTCAGCCTGGTGAATGCTCGAGCATTCACCAGGCTGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011809.2-390s21c1
Sequence:CCGGAGTGATGAGCCAAGCCTTAAACTCGAGTTTAAGGCTTGGCTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-721s1c1
Sequence:CCGGCCTCAGTGGATCAACAGCAATCTCGAGATTGCTGTTGATCCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-893s1c1
Sequence:CCGGCCGTCAATGTCAATTACTGTTCTCGAGAACAGTAATTGACATTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-1466s1c1
Sequence:CCGGGCTACGTGTACCGTTTCGTATCTCGAGATACGAAACGGTACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-238s1c1
Sequence:CCGGCCAGCCTTTGACACCTTCGATCTCGAGATCGAAGGTGTCAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011809.2-951s1c1
Sequence:CCGGGCTCAACAACAATTCTGGAAACTCGAGTTTCCAGAATTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks