EMAIL THIS PAGE TO A FRIEND

ETV1

ets variant 1

170 Gene Product Result for
Synonyms: ER81
Gene ID:
Human(2115) Summary: This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]
Mouse(14009) ets variant gene 1
Rat(362733) ets variant 1
Zebrafish(563876) ets variant gene 1
dog(475246) ets variant 1
domestic cat(101081531) ets variant 1
cow(540846) ets variant 1
Horse(100065470) ets variant 1
chicken(395748) ets variant 1
sheep(101123624) ets variant 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004956 Rosetta Predictions human pricing
NM_001108709 Rosetta Predictions rat pricing
NM_007960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155399 predicted 224
2 SASI_Hs01_00155400 predicted 1308
3 SASI_Hs01_00155401 predicted 1157
4 SASI_Hs01_00155402 predicted 761
5 SASI_Hs01_00155404 predicted 638
6 SASI_Hs01_00155405 predicted 391
7 SASI_Hs01_00155406 predicted 1227
8 SASI_Hs01_00155407 predicted 529
9 SASI_Hs02_00338636 predicted 369
10 SASI_Hs02_00338637 predicted 700
11 SASI_Hs01_00155403 predicted 911
12 SASI_Hs01_00155408 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241305 predicted 1022
2 SASI_Rn02_00241306 predicted 755
3 SASI_Rn02_00241307 predicted 790
4 SASI_Rn02_00241308 predicted 1104
5 SASI_Rn02_00241309 predicted 961
6 SASI_Rn02_00241310 predicted 258
7 SASI_Rn02_00241311 predicted 1222
8 SASI_Rn02_00241312 predicted 390
9 SASI_Rn02_00241313 predicted 312
10 SASI_Rn02_00241314 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200195 predicted 1272
2 SASI_Mm01_00200196 predicted 873
3 SASI_Mm01_00200197 predicted 1010
4 SASI_Mm01_00200198 predicted 748
5 SASI_Mm01_00200199 predicted 1014
6 SASI_Mm02_00312843 predicted 1363
7 SASI_Mm01_00200201 predicted 1096
8 SASI_Mm01_00200203 predicted 398
9 SASI_Mm02_00312844 predicted 1410
10 SASI_Mm01_00200204 predicted 504
11 SASI_Mm01_00200200 predicted 1368
12 SASI_Mm01_00200202 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004956
ETV1 MISSION shRNA Bacterial Glycerol Stock
ets variant 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004956.2-2044s1c1
Sequence:CCGGGTGGGAGTAATCTAAACATTTCTCGAGAAATGTTTAGATTACTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-872s1c1
Sequence:CCGGGCATCTCCAAACTCAACTCATCTCGAGATGAGTTGAGTTTGGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1643s1c1
Sequence:CCGGGAGAGATATGTCTACAAGTTTCTCGAGAAACTTGTAGACATATCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1117s1c1
Sequence:CCGGCGACCCAGTGTATGAACACAACTCGAGTTGTGTTCATACACTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-697s1c1
Sequence:CCGGCCACAGTCCATGTTCAGAAATCTCGAGATTTCTGAACATGGACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-2152s21c1
Sequence:CCGGCAACGAAGGCTACGTGTATTACTCGAGTAATACACGTAGCCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004956.4-2578s21c1
Sequence:CCGGTATCCACTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-1907s21c1
Sequence:CCGGAGCCGTTCACTCCGCTATTACCTCGAGGTAATAGCGGAGTGAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004956
ETV1 MISSION shRNA shRNA Plasmid DNA
ets variant 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004956.2-2044s1c1
Sequence:CCGGGTGGGAGTAATCTAAACATTTCTCGAGAAATGTTTAGATTACTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-872s1c1
Sequence:CCGGGCATCTCCAAACTCAACTCATCTCGAGATGAGTTGAGTTTGGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1643s1c1
Sequence:CCGGGAGAGATATGTCTACAAGTTTCTCGAGAAACTTGTAGACATATCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1117s1c1
Sequence:CCGGCGACCCAGTGTATGAACACAACTCGAGTTGTGTTCATACACTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-697s1c1
Sequence:CCGGCCACAGTCCATGTTCAGAAATCTCGAGATTTCTGAACATGGACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-2152s21c1
Sequence:CCGGCAACGAAGGCTACGTGTATTACTCGAGTAATACACGTAGCCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004956.4-2578s21c1
Sequence:CCGGTATCCACTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-1907s21c1
Sequence:CCGGAGCCGTTCACTCCGCTATTACCTCGAGGTAATAGCGGAGTGAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004956
ETV1 MISSION shRNA Lentiviral Transduction Particles
ets variant 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004956.2-2044s1c1
Sequence:CCGGGTGGGAGTAATCTAAACATTTCTCGAGAAATGTTTAGATTACTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-872s1c1
Sequence:CCGGGCATCTCCAAACTCAACTCATCTCGAGATGAGTTGAGTTTGGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1643s1c1
Sequence:CCGGGAGAGATATGTCTACAAGTTTCTCGAGAAACTTGTAGACATATCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-1117s1c1
Sequence:CCGGCGACCCAGTGTATGAACACAACTCGAGTTGTGTTCATACACTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004956.2-697s1c1
Sequence:CCGGCCACAGTCCATGTTCAGAAATCTCGAGATTTCTGAACATGGACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-2152s21c1
Sequence:CCGGCAACGAAGGCTACGTGTATTACTCGAGTAATACACGTAGCCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004956.4-2578s21c1
Sequence:CCGGTATCCACTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004956.4-1907s21c1
Sequence:CCGGAGCCGTTCACTCCGCTATTACCTCGAGGTAATAGCGGAGTGAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007960
VALIDATED
ETV1 MISSION shRNA Bacterial Glycerol Stock
ets variant 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-2448s1c1
Sequence:CCGGCGGAATCTTCATTTAAGTGTTCTCGAGAACACTTAAATGAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1344s1c1
Sequence:CCGGCCGGCGATGAACTATGACAAACTCGAGTTTGTCATAGTTCATCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-1241s1c1
Sequence:CCGGCCCTTCAAATTCTCATTTCATCTCGAGATGAAATGAGAATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1347s1c1
Sequence:CCGGGCGATGAACTATGACAAACTTCTCGAGAAGTTTGTCATAGTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-422s1c1
Sequence:CCGGTCAGGCTGAAAGTTTGGCTTTCTCGAGAAAGCCAAACTTTCAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1420s21c1
Sequence:CCGGGTCGTTCTCTCCGCTATTATTCTCGAGAATAATAGCGGAGAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007960.4-1885s21c1
Sequence:CCGGGCGGGAGTAATCTAGACATTCCTCGAGGAATGTCTAGATTACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1666s21c1
Sequence:CCGGACGAAGGATACGTGTACTAACCTCGAGGTTAGTACACGTATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007960
VALIDATED
ETV1 MISSION shRNA shRNA Plasmid DNA
ets variant 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-2448s1c1
Sequence:CCGGCGGAATCTTCATTTAAGTGTTCTCGAGAACACTTAAATGAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1344s1c1
Sequence:CCGGCCGGCGATGAACTATGACAAACTCGAGTTTGTCATAGTTCATCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-1241s1c1
Sequence:CCGGCCCTTCAAATTCTCATTTCATCTCGAGATGAAATGAGAATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1347s1c1
Sequence:CCGGGCGATGAACTATGACAAACTTCTCGAGAAGTTTGTCATAGTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-422s1c1
Sequence:CCGGTCAGGCTGAAAGTTTGGCTTTCTCGAGAAAGCCAAACTTTCAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1420s21c1
Sequence:CCGGGTCGTTCTCTCCGCTATTATTCTCGAGAATAATAGCGGAGAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007960.4-1885s21c1
Sequence:CCGGGCGGGAGTAATCTAGACATTCCTCGAGGAATGTCTAGATTACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1666s21c1
Sequence:CCGGACGAAGGATACGTGTACTAACCTCGAGGTTAGTACACGTATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007960
VALIDATED
ETV1 MISSION shRNA Lentiviral Transduction Particles
ets variant 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-2448s1c1
Sequence:CCGGCGGAATCTTCATTTAAGTGTTCTCGAGAACACTTAAATGAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1344s1c1
Sequence:CCGGCCGGCGATGAACTATGACAAACTCGAGTTTGTCATAGTTCATCGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007960.1-1241s1c1
Sequence:CCGGCCCTTCAAATTCTCATTTCATCTCGAGATGAAATGAGAATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-1347s1c1
Sequence:CCGGGCGATGAACTATGACAAACTTCTCGAGAAGTTTGTCATAGTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007960.1-422s1c1
Sequence:CCGGTCAGGCTGAAAGTTTGGCTTTCTCGAGAAAGCCAAACTTTCAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1420s21c1
Sequence:CCGGGTCGTTCTCTCCGCTATTATTCTCGAGAATAATAGCGGAGAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007960.4-1885s21c1
Sequence:CCGGGCGGGAGTAATCTAGACATTCCTCGAGGAATGTCTAGATTACTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007960.4-1666s21c1
Sequence:CCGGACGAAGGATACGTGTACTAACCTCGAGGTTAGTACACGTATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks