EMAIL THIS PAGE TO A FRIEND

ETV2

ets variant 2

Synonyms: ER71 ETSRP71
UniProtKB ID: O00321, B9EIN1, Q9UEA0
Gene ID:
Mouse(14008) ets variant gene 2
Rat(361544) ets variant 2
sheep(101119411) ets variant 2
Zebrafish(555766) ets variant gene 2
dog(612646) ets variant 2
domestic cat(101087889) ets variant 2
cow(514231) ets variant 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014209 Rosetta Predictions human pricing
XM_001079212 Rosetta Predictions rat pricing
XM_341830 Rosetta Predictions rat pricing
NM_007959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080150 predicted 1203
2 SASI_Hs02_00345229 predicted 522
3 SASI_Hs01_00080148 predicted 513
4 SASI_Hs01_00080152 predicted 473
5 SASI_Hs01_00080151 predicted 510
6 SASI_Hs02_00345230 predicted 582
7 SASI_Hs02_00345231 predicted 640
8 SASI_Hs02_00345232 predicted 1237
9 SASI_Hs01_00080155 predicted 511
10 SASI_Hs02_00345233 predicted 465
11 SASI_Hs01_00080147 predicted 758
12 SASI_Hs01_00080149 predicted 653
13 SASI_Hs01_00080153 predicted 761
14 SASI_Hs01_00080154 predicted 553
15 SASI_Hs01_00080156 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363525 predicted 262
2 SASI_Rn02_00363526 predicted 239
3 SASI_Rn02_00363527 predicted 731
4 SASI_Rn02_00363528 predicted 878
5 SASI_Rn02_00363529 predicted 804
6 SASI_Rn02_00363530 predicted 309
7 SASI_Rn02_00363531 predicted 788
8 SASI_Rn02_00363532 predicted 238
9 SASI_Rn02_00363533 predicted 377
10 SASI_Rn02_00363534 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393413 predicted 253
2 SASI_Rn02_00393414 predicted 243
3 SASI_Rn02_00393415 predicted 728
4 SASI_Rn02_00393416 predicted 883
5 SASI_Rn02_00393417 predicted 797
6 SASI_Rn02_00393418 predicted 307
7 SASI_Rn02_00393419 predicted 790
8 SASI_Rn02_00393420 predicted 234
9 SASI_Rn02_00393421 predicted 373
10 SASI_Rn02_00393422 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155497 predicted 675
2 SASI_Mm01_00155498 predicted 203
3 SASI_Mm02_00312842 predicted 716
4 SASI_Mm01_00155499 predicted 559
5 SASI_Mm01_00155500 predicted 206
6 SASI_Mm01_00155501 predicted 629
7 SASI_Mm01_00155502 predicted 580
8 SASI_Mm01_00155503 predicted 273
9 SASI_Mm01_00155504 predicted 624
10 SASI_Mm01_00155505 predicted 253
11 SASI_Mm01_00155506 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007959
ETV2 MISSION shRNA Bacterial Glycerol Stock
ets variant 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-658s21c1
Sequence:CCGGATCGAACAAGCAGTCTGATAGCTCGAGCTATCAGACTGCTTGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-719s21c1
Sequence:CCGGCCCATTCAGCTGTGGCAATTCCTCGAGGAATTGCCACAGCTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-863s1c1
Sequence:CCGGCCGGGAATGAATTATGAGAAACTCGAGTTTCTCATAATTCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-93s1c1
Sequence:CCGGGAGCGGAATTTGGTTTCTATTCTCGAGAATAGAAACCAAATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-521s1c1
Sequence:CCGGGAAGCGCATGAGGACTATAAACTCGAGTTTATAGTCCTCATGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-887s1c1
Sequence:CCGGAGTCGAGGTCTACGTTATTATCTCGAGATAATAACGTAGACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-888s1c1
Sequence:CCGGGTCGAGGTCTACGTTATTATTCTCGAGAATAATAACGTAGACCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007959
ETV2 MISSION shRNA shRNA Plasmid DNA
ets variant 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-658s21c1
Sequence:CCGGATCGAACAAGCAGTCTGATAGCTCGAGCTATCAGACTGCTTGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-719s21c1
Sequence:CCGGCCCATTCAGCTGTGGCAATTCCTCGAGGAATTGCCACAGCTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-863s1c1
Sequence:CCGGCCGGGAATGAATTATGAGAAACTCGAGTTTCTCATAATTCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-93s1c1
Sequence:CCGGGAGCGGAATTTGGTTTCTATTCTCGAGAATAGAAACCAAATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-521s1c1
Sequence:CCGGGAAGCGCATGAGGACTATAAACTCGAGTTTATAGTCCTCATGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-887s1c1
Sequence:CCGGAGTCGAGGTCTACGTTATTATCTCGAGATAATAACGTAGACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-888s1c1
Sequence:CCGGGTCGAGGTCTACGTTATTATTCTCGAGAATAATAACGTAGACCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007959
ETV2 MISSION shRNA Lentiviral Transduction Particles
ets variant 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-658s21c1
Sequence:CCGGATCGAACAAGCAGTCTGATAGCTCGAGCTATCAGACTGCTTGTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007959.2-719s21c1
Sequence:CCGGCCCATTCAGCTGTGGCAATTCCTCGAGGAATTGCCACAGCTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-863s1c1
Sequence:CCGGCCGGGAATGAATTATGAGAAACTCGAGTTTCTCATAATTCATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-93s1c1
Sequence:CCGGGAGCGGAATTTGGTTTCTATTCTCGAGAATAGAAACCAAATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-521s1c1
Sequence:CCGGGAAGCGCATGAGGACTATAAACTCGAGTTTATAGTCCTCATGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-887s1c1
Sequence:CCGGAGTCGAGGTCTACGTTATTATCTCGAGATAATAACGTAGACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007959.1-888s1c1
Sequence:CCGGGTCGAGGTCTACGTTATTATTCTCGAGAATAATAACGTAGACCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014209
ETV2 MISSION shRNA Bacterial Glycerol Stock
ets variant 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-585s1c1
Sequence:CCGGGAGCCAAATTAGGCTTCTGTTCTCGAGAACAGAAGCCTAATTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-710s1c1
Sequence:CCGGTCCGCGTTACTGCACCCAGAACTCGAGTTCTGGGTGCAGTAACGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1285s1c1
Sequence:CCGGCTGCATCCGTTGGACTGGCAACTCGAGTTGCCAGTCCAACGGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1117s1c1
Sequence:CCGGCACCACCTCTTTGAAGCGGTACTCGAGTACCGCTTCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-657s1c1
Sequence:CCGGGCTGGAAAGGTACAAGCTCATCTCGAGATGAGCTTGTACCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014209
ETV2 MISSION shRNA shRNA Plasmid DNA
ets variant 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-585s1c1
Sequence:CCGGGAGCCAAATTAGGCTTCTGTTCTCGAGAACAGAAGCCTAATTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-710s1c1
Sequence:CCGGTCCGCGTTACTGCACCCAGAACTCGAGTTCTGGGTGCAGTAACGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1285s1c1
Sequence:CCGGCTGCATCCGTTGGACTGGCAACTCGAGTTGCCAGTCCAACGGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1117s1c1
Sequence:CCGGCACCACCTCTTTGAAGCGGTACTCGAGTACCGCTTCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-657s1c1
Sequence:CCGGGCTGGAAAGGTACAAGCTCATCTCGAGATGAGCTTGTACCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014209
ETV2 MISSION shRNA Lentiviral Transduction Particles
ets variant 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-585s1c1
Sequence:CCGGGAGCCAAATTAGGCTTCTGTTCTCGAGAACAGAAGCCTAATTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-710s1c1
Sequence:CCGGTCCGCGTTACTGCACCCAGAACTCGAGTTCTGGGTGCAGTAACGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1285s1c1
Sequence:CCGGCTGCATCCGTTGGACTGGCAACTCGAGTTGCCAGTCCAACGGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-1117s1c1
Sequence:CCGGCACCACCTCTTTGAAGCGGTACTCGAGTACCGCTTCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014209.1-657s1c1
Sequence:CCGGGCTGGAAAGGTACAAGCTCATCTCGAGATGAGCTTGTACCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks