EMAIL THIS PAGE TO A FRIEND

ETV3

ets variant 3

66 Gene Product Result for
Synonyms: METS PE-1 PE1 bA110J1.4
UniProtKB ID: P41162, B4E3M7, Q8TAC8, Q9BX30
Gene ID:
Mouse(27049) ets variant gene 3
Rat(295297) ets variant 3
chicken(426718) ets variant 3
dog(480119) ets variant 3
cow(538995) ets variant 3
domestic cat(101081520) ets variant 3
sheep(101108528) ets variant 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068971 MISSION® esiRNA esiRNA human ETV3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005240 Rosetta Predictions human pricing
NM_001106450 Rosetta Predictions rat pricing
NM_001083318 Rosetta Predictions mouse pricing
NM_012051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203715 predicted 642
2 SASI_Hs01_00203716 predicted 470
3 SASI_Hs01_00203717 predicted 623
4 SASI_Hs01_00203718 predicted 632
5 SASI_Hs01_00203719 predicted 736
6 SASI_Hs02_00339245 predicted 653
7 SASI_Hs01_00203720 predicted 730
8 SASI_Hs01_00203721 predicted 628
9 SASI_Hs01_00203722 predicted 453
10 SASI_Hs01_00203723 predicted 641
11 SASI_Hs01_00203724 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219078 predicted 630
2 SASI_Rn02_00219079 predicted 378
3 SASI_Rn02_00219080 predicted 1063
4 SASI_Rn02_00219081 predicted 1061
5 SASI_Rn02_00219082 predicted 1123
6 SASI_Rn02_00219083 predicted 656
7 SASI_Rn02_00219084 predicted 658
8 SASI_Rn02_00219085 predicted 891
9 SASI_Rn02_00219086 predicted 832
10 SASI_Rn02_00219087 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299601 predicted 556
2 SASI_Mm02_00299602 predicted 1208
3 SASI_Mm02_00299603 predicted 1004
4 SASI_Mm02_00299604 predicted 319
5 SASI_Mm02_00299605 predicted 1301
6 SASI_Mm02_00299606 predicted 759
7 SASI_Mm02_00299607 predicted 1017
8 SASI_Mm02_00299608 predicted 1512
9 SASI_Mm02_00299609 predicted 1505
10 SASI_Mm02_00299610 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062629 predicted 561
2 SASI_Mm01_00062631 predicted 1203
3 SASI_Mm01_00062633 predicted 1003
4 SASI_Mm01_00062634 predicted 318
5 SASI_Mm01_00062630 predicted 1301
6 SASI_Mm01_00062637 predicted 758
7 SASI_Mm02_00322021 predicted 1014
8 SASI_Mm02_00322022 predicted 1506
9 SASI_Mm02_00322023 predicted 1509
10 SASI_Mm02_00322024 predicted 555
11 SASI_Mm01_00062632 predicted 583
12 SASI_Mm01_00062635 predicted 229
13 SASI_Mm01_00062636 predicted 1300
14 SASI_Mm01_00062638 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005240
ETV3 MISSION shRNA Bacterial Glycerol Stock
ets variant 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005240.1-1066s1c1
Sequence:CCGGCCTCTTGACTTTCCTGGTTATCTCGAGATAACCAGGAAAGTCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-366s1c1
Sequence:CCGGCCTCAGATACTATTACAACAACTCGAGTTGTTGTAATAGTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-474s1c1
Sequence:CCGGCATTCGGTCAAGTGGTAAGATCTCGAGATCTTACCACTTGACCGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-453s1c1
Sequence:CCGGGCCCAACTACCCATTCATCAACTCGAGTTGATGAATGGGTAGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-324s1c1
Sequence:CCGGGAAATGCAAACCACAGATGAACTCGAGTTCATCTGTGGTTTGCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-727s21c1
Sequence:CCGGTGTAATCTCCTAGATACTATTCTCGAGAATAGTATCTAGGAGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-120s21c1
Sequence:CCGGAGAAGGAGGTGGAGGGTATCACTCGAGTGATACCCTCCACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-142s21c1
Sequence:CCGGTTTCCTGACTGGGCCTACAAACTCGAGTTTGTAGGCCCAGTCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-648s21c1
Sequence:CCGGTAAGGAGAGTTATAGGCTATTCTCGAGAATAGCCTATAACTCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005240
ETV3 MISSION shRNA shRNA Plasmid DNA
ets variant 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005240.1-1066s1c1
Sequence:CCGGCCTCTTGACTTTCCTGGTTATCTCGAGATAACCAGGAAAGTCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-366s1c1
Sequence:CCGGCCTCAGATACTATTACAACAACTCGAGTTGTTGTAATAGTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-474s1c1
Sequence:CCGGCATTCGGTCAAGTGGTAAGATCTCGAGATCTTACCACTTGACCGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-453s1c1
Sequence:CCGGGCCCAACTACCCATTCATCAACTCGAGTTGATGAATGGGTAGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-324s1c1
Sequence:CCGGGAAATGCAAACCACAGATGAACTCGAGTTCATCTGTGGTTTGCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-727s21c1
Sequence:CCGGTGTAATCTCCTAGATACTATTCTCGAGAATAGTATCTAGGAGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-120s21c1
Sequence:CCGGAGAAGGAGGTGGAGGGTATCACTCGAGTGATACCCTCCACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-142s21c1
Sequence:CCGGTTTCCTGACTGGGCCTACAAACTCGAGTTTGTAGGCCCAGTCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-648s21c1
Sequence:CCGGTAAGGAGAGTTATAGGCTATTCTCGAGAATAGCCTATAACTCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005240
ETV3 MISSION shRNA Lentiviral Transduction Particles
ets variant 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005240.1-1066s1c1
Sequence:CCGGCCTCTTGACTTTCCTGGTTATCTCGAGATAACCAGGAAAGTCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-366s1c1
Sequence:CCGGCCTCAGATACTATTACAACAACTCGAGTTGTTGTAATAGTATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-474s1c1
Sequence:CCGGCATTCGGTCAAGTGGTAAGATCTCGAGATCTTACCACTTGACCGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-453s1c1
Sequence:CCGGGCCCAACTACCCATTCATCAACTCGAGTTGATGAATGGGTAGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005240.1-324s1c1
Sequence:CCGGGAAATGCAAACCACAGATGAACTCGAGTTCATCTGTGGTTTGCATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-727s21c1
Sequence:CCGGTGTAATCTCCTAGATACTATTCTCGAGAATAGTATCTAGGAGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-120s21c1
Sequence:CCGGAGAAGGAGGTGGAGGGTATCACTCGAGTGATACCCTCCACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005240.1-142s21c1
Sequence:CCGGTTTCCTGACTGGGCCTACAAACTCGAGTTTGTAGGCCCAGTCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005240.1-648s21c1
Sequence:CCGGTAAGGAGAGTTATAGGCTATTCTCGAGAATAGCCTATAACTCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012051
VALIDATED
ETV3 MISSION shRNA Bacterial Glycerol Stock
ets variant 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-356s1c1
Sequence:CCGGCCCTCAGATACTATTACAACACTCGAGTGTTGTAATAGTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-1507s1c1
Sequence:CCGGCGGTGGAATGACGACCCTGAACTCGAGTTCAGGGTCGTCATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012051.2-523s1c1
Sequence:CCGGCGGTTCCATTTCCCACCTCTACTCGAGTAGAGGTGGGAAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-997s1c1
Sequence:CCGGTGTTCGGTGTTCAACTACCATCTCGAGATGGTAGTTGAACACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-4811s21c1
Sequence:CCGGACTTGTGATGCAGGGATTTATCTCGAGATAAATCCCTGCATCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-711s21c1
Sequence:CCGGGACTTCATGCCCTCCCGAAATCTCGAGATTTCGGGAGGGCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-386s21c1
Sequence:CCGGCAACAAGAGGATCCTTCATAACTCGAGTTATGAAGGATCCTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-1214s21c1
Sequence:CCGGTCCTGTTCCCTCTCGGATTAACTCGAGTTAATCCGAGAGGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012051
VALIDATED
ETV3 MISSION shRNA shRNA Plasmid DNA
ets variant 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-356s1c1
Sequence:CCGGCCCTCAGATACTATTACAACACTCGAGTGTTGTAATAGTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-1507s1c1
Sequence:CCGGCGGTGGAATGACGACCCTGAACTCGAGTTCAGGGTCGTCATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012051.2-523s1c1
Sequence:CCGGCGGTTCCATTTCCCACCTCTACTCGAGTAGAGGTGGGAAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-997s1c1
Sequence:CCGGTGTTCGGTGTTCAACTACCATCTCGAGATGGTAGTTGAACACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-4811s21c1
Sequence:CCGGACTTGTGATGCAGGGATTTATCTCGAGATAAATCCCTGCATCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-711s21c1
Sequence:CCGGGACTTCATGCCCTCCCGAAATCTCGAGATTTCGGGAGGGCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-386s21c1
Sequence:CCGGCAACAAGAGGATCCTTCATAACTCGAGTTATGAAGGATCCTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-1214s21c1
Sequence:CCGGTCCTGTTCCCTCTCGGATTAACTCGAGTTAATCCGAGAGGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012051
VALIDATED
ETV3 MISSION shRNA Lentiviral Transduction Particles
ets variant 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-356s1c1
Sequence:CCGGCCCTCAGATACTATTACAACACTCGAGTGTTGTAATAGTATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-1507s1c1
Sequence:CCGGCGGTGGAATGACGACCCTGAACTCGAGTTCAGGGTCGTCATTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012051.2-523s1c1
Sequence:CCGGCGGTTCCATTTCCCACCTCTACTCGAGTAGAGGTGGGAAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012051.2-997s1c1
Sequence:CCGGTGTTCGGTGTTCAACTACCATCTCGAGATGGTAGTTGAACACCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-4811s21c1
Sequence:CCGGACTTGTGATGCAGGGATTTATCTCGAGATAAATCCCTGCATCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-711s21c1
Sequence:CCGGGACTTCATGCCCTCCCGAAATCTCGAGATTTCGGGAGGGCATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-386s21c1
Sequence:CCGGCAACAAGAGGATCCTTCATAACTCGAGTTATGAAGGATCCTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012051.3-1214s21c1
Sequence:CCGGTCCTGTTCCCTCTCGGATTAACTCGAGTTAATCCGAGAGGGAACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks