EMAIL THIS PAGE TO A FRIEND

ETV3L

ets variant 3-like

38 Gene Product Result for
UniProtKB ID: Q6ZN32
Gene ID:
Mouse(546801) ets variant gene 3-like
Rat(499651) ets variant 3-like
domestic guinea pig(100717394) ets variant 3-like
naked mole-rat(101698998) ets variant 3-like
sheep(101110812) ets variant 3-like
chicken(100857713) ets variant 3-like
cow(524013) ets variant 3-like
domestic cat(101081782) ets variant 3-like
dog(612067) ets variant 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004341 Rosetta Predictions human pricing
NM_001100992 Rosetta Predictions rat pricing
XM_621583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042892 predicted 1177
2 SASI_Hs01_00042893 predicted 594
3 SASI_Hs01_00042894 predicted 660
4 SASI_Hs01_00042895 predicted 1355
5 SASI_Hs01_00042896 predicted 1346
6 SASI_Hs01_00042898 predicted 1219
7 SASI_Hs01_00042899 predicted 1455
8 SASI_Hs01_00042900 predicted 1603
9 SASI_Hs01_00042901 predicted 879
10 SASI_Hs02_00304561 predicted 1714
11 SASI_Hs01_00042897 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211062 predicted 547
2 SASI_Rn02_00211063 predicted 1024
3 SASI_Rn02_00211064 predicted 584
4 SASI_Rn02_00211065 predicted 1150
5 SASI_Rn02_00211066 predicted 844
6 SASI_Rn02_00211067 predicted 939
7 SASI_Rn02_00211068 predicted 830
8 SASI_Rn02_00211069 predicted 570
9 SASI_Rn02_00211070 predicted 718
10 SASI_Rn02_00211071 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427809 predicted 285
2 SASI_Mm02_00427810 predicted 377
3 SASI_Mm02_00427811 predicted 364
4 SASI_Mm02_00427812 predicted 515
5 SASI_Mm02_00427813 predicted 334
6 SASI_Mm02_00427814 predicted 843
7 SASI_Mm02_00427815 predicted 461
8 SASI_Mm02_00427816 predicted 313
9 SASI_Mm02_00427817 predicted 323
10 SASI_Mm02_00427818 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004341
ETV3L MISSION shRNA Bacterial Glycerol Stock
ets variant 3-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1407s1c1
Sequence:CCGGCCAAAGTCCATCTCTCCTCTTCTCGAGAAGAGGAGAGATGGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-591s1c1
Sequence:CCGGCAATAAGAGGATCCTGCATAACTCGAGTTATGCAGGATCCTCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1584s1c1
Sequence:CCGGCCATATTGCTAAGCAGACTAACTCGAGTTAGTCTGCTTAGCAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1471s1c1
Sequence:CCGGGCTGAAATTGCAGGATTTGAACTCGAGTTCAAATCCTGCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-780s1c1
Sequence:CCGGCAGCATGCTATTTGCCCATCACTCGAGTGATGGGCAAATAGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-778s1c1
Sequence:CCGGCACAGCATGCTATTTGCCCATCTCGAGATGGGCAAATAGCATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-664s1c1
Sequence:CCGGGTCAACTATCCTTTGTGGGAACTCGAGTTCCCACAAAGGATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-650s1c1
Sequence:CCGGGCAAGCTCATCGTAGTCAACTCTCGAGAGTTGACTACGATGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1819s1c1
Sequence:CCGGCCTCTGATTTCTGAGACCCTACTCGAGTAGGGTCTCAGAAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004341
ETV3L MISSION shRNA shRNA Plasmid DNA
ets variant 3-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1407s1c1
Sequence:CCGGCCAAAGTCCATCTCTCCTCTTCTCGAGAAGAGGAGAGATGGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-591s1c1
Sequence:CCGGCAATAAGAGGATCCTGCATAACTCGAGTTATGCAGGATCCTCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1584s1c1
Sequence:CCGGCCATATTGCTAAGCAGACTAACTCGAGTTAGTCTGCTTAGCAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1471s1c1
Sequence:CCGGGCTGAAATTGCAGGATTTGAACTCGAGTTCAAATCCTGCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-780s1c1
Sequence:CCGGCAGCATGCTATTTGCCCATCACTCGAGTGATGGGCAAATAGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-778s1c1
Sequence:CCGGCACAGCATGCTATTTGCCCATCTCGAGATGGGCAAATAGCATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-664s1c1
Sequence:CCGGGTCAACTATCCTTTGTGGGAACTCGAGTTCCCACAAAGGATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-650s1c1
Sequence:CCGGGCAAGCTCATCGTAGTCAACTCTCGAGAGTTGACTACGATGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1819s1c1
Sequence:CCGGCCTCTGATTTCTGAGACCCTACTCGAGTAGGGTCTCAGAAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004341
ETV3L MISSION shRNA Lentiviral Transduction Particles
ets variant 3-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1407s1c1
Sequence:CCGGCCAAAGTCCATCTCTCCTCTTCTCGAGAAGAGGAGAGATGGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-591s1c1
Sequence:CCGGCAATAAGAGGATCCTGCATAACTCGAGTTATGCAGGATCCTCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1584s1c1
Sequence:CCGGCCATATTGCTAAGCAGACTAACTCGAGTTAGTCTGCTTAGCAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1471s1c1
Sequence:CCGGGCTGAAATTGCAGGATTTGAACTCGAGTTCAAATCCTGCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-780s1c1
Sequence:CCGGCAGCATGCTATTTGCCCATCACTCGAGTGATGGGCAAATAGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-778s1c1
Sequence:CCGGCACAGCATGCTATTTGCCCATCTCGAGATGGGCAAATAGCATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-664s1c1
Sequence:CCGGGTCAACTATCCTTTGTGGGAACTCGAGTTCCCACAAAGGATAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004341.1-650s1c1
Sequence:CCGGGCAAGCTCATCGTAGTCAACTCTCGAGAGTTGACTACGATGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004341.1-1819s1c1
Sequence:CCGGCCTCTGATTTCTGAGACCCTACTCGAGTAGGGTCTCAGAAATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks