EMAIL THIS PAGE TO A FRIEND

ETV5

ets variant 5

Synonyms: ERM
UniProtKB ID: P41161, A6NH46, Q6IBN5
Gene ID:
Mouse(104156) ets variant gene 5
Rat(303828) ets variant 5
sheep(101115418) ets variant 5
chicken(395749) ets variant 5
dog(607474) ets variant 5
domestic cat(101101405) ets variant 5
cow(541166) ets variant 5
Horse(100059346) ets variant 5
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004454 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055871 MISSION® esiRNA esiRNA human ETV5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004454 Rosetta Predictions human pricing
NM_001107082 Rosetta Predictions rat pricing
NM_023794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230618 predicted 437
2 SASI_Hs01_00230619 predicted 1134
3 SASI_Hs01_00230620 predicted 1106
4 SASI_Hs01_00230621 predicted 357
5 SASI_Hs01_00230622 predicted 1594
6 SASI_Hs01_00230623 predicted 329
7 SASI_Hs01_00230624 predicted 472
8 SASI_Hs01_00230625 predicted 266
9 SASI_Hs01_00230626 predicted 1689
10 SASI_Hs01_00230627 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225316 predicted 1741
2 SASI_Rn02_00225317 predicted 1722
3 SASI_Rn02_00225318 predicted 225
4 SASI_Rn02_00225319 predicted 1126
5 SASI_Rn02_00225320 predicted 1718
6 SASI_Rn02_00225321 predicted 1069
7 SASI_Rn02_00225322 predicted 245
8 SASI_Rn02_00225323 predicted 315
9 SASI_Rn02_00225324 predicted 1761
10 SASI_Rn02_00225325 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026515 predicted 202
2 SASI_Mm01_00026516 predicted 218
3 SASI_Mm01_00026517 predicted 351
4 SASI_Mm02_00327362 predicted 1047
5 SASI_Mm01_00026519 predicted 1597
6 SASI_Mm01_00026520 predicted 236
7 SASI_Mm02_00327363 predicted 310
8 SASI_Mm02_00327364 predicted 750
9 SASI_Mm02_00327365 predicted 1091
10 SASI_Mm01_00026522 predicted 1307
11 SASI_Mm01_00026518 predicted 223
12 SASI_Mm01_00026521 predicted 295
13 SASI_Mm01_00026523 predicted 209
14 SASI_Mm01_00026524 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023794
VALIDATED
ETV5 MISSION shRNA Bacterial Glycerol Stock
ets variant 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1066s21c1
Sequence:CCGGTACATGAGAGGCGGGTATTTCCTCGAGGAAATACCCGCCTCTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-485s21c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-380s21c1
Sequence:CCGGCACCTCCCACCAAGATCAAACCTCGAGGTTTGATCTTGGTGGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-1646s21c1
Sequence:CCGGCCGAAGGCTTCGCTTACTAAGCTCGAGCTTAGTAAGCGAAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1762s21c1
Sequence:CCGGAGCTTGCCCTTTGAGTATTATCTCGAGATAATACTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-204s1c1
Sequence:CCGGGCGACCTTTGATTGACAGAAACTCGAGTTTCTGTCAATCAAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-352s1c1
Sequence:CCGGCAGTCTGATAACTTGGTGCTTCTCGAGAAGCACCAAGTTATCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-1374s1c1
Sequence:CCGGGCCAGCCATGAACTATGACAACTCGAGTTGTCATAGTTCATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-226s1c1
Sequence:CCGGAGGAAGTTTGTGGACACAGATCTCGAGATCTGTGTCCACAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-485s1c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023794
VALIDATED
ETV5 MISSION shRNA shRNA Plasmid DNA
ets variant 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1066s21c1
Sequence:CCGGTACATGAGAGGCGGGTATTTCCTCGAGGAAATACCCGCCTCTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-485s21c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-380s21c1
Sequence:CCGGCACCTCCCACCAAGATCAAACCTCGAGGTTTGATCTTGGTGGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-1646s21c1
Sequence:CCGGCCGAAGGCTTCGCTTACTAAGCTCGAGCTTAGTAAGCGAAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1762s21c1
Sequence:CCGGAGCTTGCCCTTTGAGTATTATCTCGAGATAATACTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-204s1c1
Sequence:CCGGGCGACCTTTGATTGACAGAAACTCGAGTTTCTGTCAATCAAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-352s1c1
Sequence:CCGGCAGTCTGATAACTTGGTGCTTCTCGAGAAGCACCAAGTTATCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-1374s1c1
Sequence:CCGGGCCAGCCATGAACTATGACAACTCGAGTTGTCATAGTTCATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-226s1c1
Sequence:CCGGAGGAAGTTTGTGGACACAGATCTCGAGATCTGTGTCCACAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-485s1c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023794
VALIDATED
ETV5 MISSION shRNA Lentiviral Transduction Particles
ets variant 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1066s21c1
Sequence:CCGGTACATGAGAGGCGGGTATTTCCTCGAGGAAATACCCGCCTCTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-485s21c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-380s21c1
Sequence:CCGGCACCTCCCACCAAGATCAAACCTCGAGGTTTGATCTTGGTGGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023794.2-1646s21c1
Sequence:CCGGCCGAAGGCTTCGCTTACTAAGCTCGAGCTTAGTAAGCGAAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023794.2-1762s21c1
Sequence:CCGGAGCTTGCCCTTTGAGTATTATCTCGAGATAATACTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-204s1c1
Sequence:CCGGGCGACCTTTGATTGACAGAAACTCGAGTTTCTGTCAATCAAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-352s1c1
Sequence:CCGGCAGTCTGATAACTTGGTGCTTCTCGAGAAGCACCAAGTTATCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-1374s1c1
Sequence:CCGGGCCAGCCATGAACTATGACAACTCGAGTTGTCATAGTTCATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023794.2-226s1c1
Sequence:CCGGAGGAAGTTTGTGGACACAGATCTCGAGATCTGTGTCCACAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023794.2-485s1c1
Sequence:CCGGACAACTATTGTGCCTACGATACTCGAGTATCGTAGGCACAATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004454
VALIDATED
ETV5 MISSION shRNA Bacterial Glycerol Stock
ets variant 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-3287s21c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1568s21c1
Sequence:CCGGGAGCGATACGTCTACAAATTTCTCGAGAAATTTGTAGACGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1613s21c1
Sequence:CCGGTCCATGGCTTTCCCGGATAACCTCGAGGTTATCCGGGAAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-495s21c1
Sequence:CCGGCACCTCCAACCAAGATCAAACCTCGAGGTTTGATCTTGGTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-572s1c1
Sequence:CCGGCTCTACAACTATTGTGCCTATCTCGAGATAGGCACAATAGTTGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-342s1c1
Sequence:CCGGCTCACGATTCTGAAGAGCTATCTCGAGATAGCTCTTCAGAATCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-1352s1c1
Sequence:CCGGCTTCTTGATGACCCAGCCAATCTCGAGATTGGCTGGGTCATCAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-956s1c1
Sequence:CCGGCGGCAAATGTCAGAACCTATTCTCGAGAATAGGTTCTGACATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-3258s1c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004454
VALIDATED
ETV5 MISSION shRNA shRNA Plasmid DNA
ets variant 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-3287s21c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1568s21c1
Sequence:CCGGGAGCGATACGTCTACAAATTTCTCGAGAAATTTGTAGACGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1613s21c1
Sequence:CCGGTCCATGGCTTTCCCGGATAACCTCGAGGTTATCCGGGAAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-495s21c1
Sequence:CCGGCACCTCCAACCAAGATCAAACCTCGAGGTTTGATCTTGGTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-572s1c1
Sequence:CCGGCTCTACAACTATTGTGCCTATCTCGAGATAGGCACAATAGTTGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-342s1c1
Sequence:CCGGCTCACGATTCTGAAGAGCTATCTCGAGATAGCTCTTCAGAATCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-1352s1c1
Sequence:CCGGCTTCTTGATGACCCAGCCAATCTCGAGATTGGCTGGGTCATCAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-956s1c1
Sequence:CCGGCGGCAAATGTCAGAACCTATTCTCGAGAATAGGTTCTGACATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-3258s1c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004454
VALIDATED
ETV5 MISSION shRNA Lentiviral Transduction Particles
ets variant 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-3287s21c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1568s21c1
Sequence:CCGGGAGCGATACGTCTACAAATTTCTCGAGAAATTTGTAGACGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-1613s21c1
Sequence:CCGGTCCATGGCTTTCCCGGATAACCTCGAGGTTATCCGGGAAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004454.2-495s21c1
Sequence:CCGGCACCTCCAACCAAGATCAAACCTCGAGGTTTGATCTTGGTTGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-572s1c1
Sequence:CCGGCTCTACAACTATTGTGCCTATCTCGAGATAGGCACAATAGTTGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-342s1c1
Sequence:CCGGCTCACGATTCTGAAGAGCTATCTCGAGATAGCTCTTCAGAATCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004454.1-1352s1c1
Sequence:CCGGCTTCTTGATGACCCAGCCAATCTCGAGATTGGCTGGGTCATCAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-956s1c1
Sequence:CCGGCGGCAAATGTCAGAACCTATTCTCGAGAATAGGTTCTGACATTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004454.1-3258s1c1
Sequence:CCGGCCGTGACACTTAGTACATTAACTCGAGTTAATGTACTAAGTGTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks