EMAIL THIS PAGE TO A FRIEND

ETV6

ets variant 6

171 Gene Product Result for
Synonyms: TEL TEL/ABL
UniProtKB ID: P41212, A3QVP6, A8K076, Q9UMF6, Q9UMF7, Q9UMG0
Gene ID:
Human(2120) Summary: This gene encodes an ETS family transcription factor. The product of this gene contains two functional domains: a N-terminal pointed (PNT) domain that is involved in protein-protein interactions with itself and other proteins, and a C-terminal DNA-binding domain. Gene knockout studies in mice suggest that it is required for hematopoiesis and maintenance of the developing vascular network. This gene is known to be involved in a large number of chromosomal rearrangements associated with leukemia and congenital fibrosarcoma. [provided by RefSeq, Sep 2008]
Mouse(14011) ets variant gene 6 (TEL oncogene)
Rat(312777) ets variant 6
Zebrafish(114444) ets variant gene 6 (TEL oncogene)
cow(504512) ets variant 6
Horse(100063341) ets variant 6
domestic cat(101081738) ets variant 6
dog(486685) ets variant 6
chicken(395750) ets variant gene 6 (TEL oncogene)
sheep(101119464) ets variant 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100720 Anti-ETV6 (ab1) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, rat, canine, zebrafish, rabbit, horse, guinea pig
western blot pricing
SAB2100721 Anti-ETV6 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, horse, rabbit, canine, bovine, human
western blot pricing
HPA000264 Anti-ETV6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV100807 Anti-ETV6 antibody produced in rabbit affinity isolated antibody canine, zebrafish, guinea pig, human, rabbit, bovine, zebrafish, mouse, rat, horse
western blot pricing
SAB4500818 Anti-ETV6, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
WH0002120M1 Monoclonal Anti-ETV6 antibody produced in mouse clone 3B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001987 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001987 Rosetta Predictions human pricing
NM_001037353 Rosetta Predictions rat pricing
NM_007961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028592 predicted 578
2 SASI_Hs02_00332972 predicted 1297
3 SASI_Hs01_00028594 predicted 639
4 SASI_Hs01_00028595 predicted 1267
5 SASI_Hs01_00028596 predicted 1374
6 SASI_Hs01_00028597 predicted 1288
7 SASI_Hs01_00028598 predicted 609
8 SASI_Hs01_00028599 predicted 780
9 SASI_Hs01_00028600 predicted 566
10 SASI_Hs02_00332973 predicted 589
11 SASI_Hs01_00028591 predicted 527
12 SASI_Hs01_00028593 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032898 predicted 385
2 SASI_Rn01_00032899 predicted 1040
3 SASI_Rn02_00204398 predicted 344
4 SASI_Rn01_00032900 predicted 1345
5 SASI_Rn01_00032901 predicted 1121
6 SASI_Rn01_00032902 predicted 1028
7 SASI_Rn01_00032904 predicted 303
8 SASI_Rn01_00032905 predicted 956
9 SASI_Rn02_00204399 predicted 471
10 SASI_Rn01_00032906 predicted 1333
11 SASI_Rn01_00032897 predicted 1025
12 SASI_Rn01_00032903 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145766 predicted 776
2 SASI_Mm01_00145767 predicted 1583
3 SASI_Mm01_00145768 predicted 739
4 SASI_Mm01_00145769 predicted 1379
5 SASI_Mm01_00145770 predicted 644
6 SASI_Mm01_00145771 predicted 1487
7 SASI_Mm01_00145772 predicted 1407
8 SASI_Mm01_00145775 predicted 1330
9 SASI_Mm02_00312845 predicted 635
10 SASI_Mm02_00312846 predicted 770
11 SASI_Mm01_00145773 predicted 857
12 SASI_Mm01_00145774 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001987
VALIDATED
ETV6 MISSION shRNA Bacterial Glycerol Stock
ets variant 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1343s1c1
Sequence:CCGGAGGAGCTGGATGAACAAATATCTCGAGATATTTGTTCATCCAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1170s1c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-309s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGACTTCTCGAGAAGTCCTCTTTGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1218s1c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1677s1c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-1468s21c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-434s21c1
Sequence:CCGGCTGCGCTTGCAGCCAATTTACCTCGAGGTAAATTGGCTGCAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1420s21c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1927s21c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001987
VALIDATED
ETV6 MISSION shRNA shRNA Plasmid DNA
ets variant 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1343s1c1
Sequence:CCGGAGGAGCTGGATGAACAAATATCTCGAGATATTTGTTCATCCAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1170s1c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-309s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGACTTCTCGAGAAGTCCTCTTTGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1218s1c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1677s1c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-1468s21c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-434s21c1
Sequence:CCGGCTGCGCTTGCAGCCAATTTACCTCGAGGTAAATTGGCTGCAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1420s21c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1927s21c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001987
VALIDATED
ETV6 MISSION shRNA Lentiviral Transduction Particles
ets variant 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1343s1c1
Sequence:CCGGAGGAGCTGGATGAACAAATATCTCGAGATATTTGTTCATCCAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1170s1c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-309s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGACTTCTCGAGAAGTCCTCTTTGGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1218s1c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001987.x-1677s1c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-1468s21c1
Sequence:CCGGGCGCCACTACTACAAACTAAACTCGAGTTTAGTTTGTAGTAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001987.4-434s21c1
Sequence:CCGGCTGCGCTTGCAGCCAATTTACCTCGAGGTAAATTGGCTGCAAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1420s21c1
Sequence:CCGGCCATAAGAACAGAACAAACATCTCGAGATGTTTGTTCTGTTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001987.4-1927s21c1
Sequence:CCGGGTTGTTAGTATCATGGTGTTTCTCGAGAAACACCATGATACTAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007961
VALIDATED
ETV6 MISSION shRNA Bacterial Glycerol Stock
ets variant 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007961.2-1677s1c1
Sequence:CCGGCGCTTCTCCTTCTGATCTCTTCTCGAGAAGAGATCAGAAGGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-549s1c1
Sequence:CCGGCTGCATCAGAACCATGACGAACTCGAGTTCGTCATGGTTCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-392s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGATTTCTCGAGAAATCCTCTTTGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-279s1c1
Sequence:CCGGCCGATTTACTGGAGCAGAGATCTCGAGATCTCTGCTCCAGTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-1022s1c1
Sequence:CCGGCCTGGCTTACTTGAACCACATCTCGAGATGTGGTTCAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007961.3-4293s21c1
Sequence:CCGGTCGACATTAAAGCGACATTAACTCGAGTTAATGTCGCTTTAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-1112s21c1
Sequence:CCGGCAGTGTCTCCTGTCGAGAATACTCGAGTATTCTCGACAGGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-849s21c1
Sequence:CCGGTCAGAACCATGACGAAGATAACTCGAGTTATCTTCGTCATGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007961.3-425s21c1
Sequence:CCGGGCATTAAGCAGGAACGAATTTCTCGAGAAATTCGTTCCTGCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-562s21c1
Sequence:CCGGCTGCGTTTGCAGCCGATTTACCTCGAGGTAAATCGGCTGCAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007961
VALIDATED
ETV6 MISSION shRNA shRNA Plasmid DNA
ets variant 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007961.2-1677s1c1
Sequence:CCGGCGCTTCTCCTTCTGATCTCTTCTCGAGAAGAGATCAGAAGGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-549s1c1
Sequence:CCGGCTGCATCAGAACCATGACGAACTCGAGTTCGTCATGGTTCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-392s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGATTTCTCGAGAAATCCTCTTTGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-279s1c1
Sequence:CCGGCCGATTTACTGGAGCAGAGATCTCGAGATCTCTGCTCCAGTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-1022s1c1
Sequence:CCGGCCTGGCTTACTTGAACCACATCTCGAGATGTGGTTCAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007961.3-4293s21c1
Sequence:CCGGTCGACATTAAAGCGACATTAACTCGAGTTAATGTCGCTTTAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-1112s21c1
Sequence:CCGGCAGTGTCTCCTGTCGAGAATACTCGAGTATTCTCGACAGGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-849s21c1
Sequence:CCGGTCAGAACCATGACGAAGATAACTCGAGTTATCTTCGTCATGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007961.3-425s21c1
Sequence:CCGGGCATTAAGCAGGAACGAATTTCTCGAGAAATTCGTTCCTGCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-562s21c1
Sequence:CCGGCTGCGTTTGCAGCCGATTTACCTCGAGGTAAATCGGCTGCAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007961
VALIDATED
ETV6 MISSION shRNA Lentiviral Transduction Particles
ets variant 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007961.2-1677s1c1
Sequence:CCGGCGCTTCTCCTTCTGATCTCTTCTCGAGAAGAGATCAGAAGGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-549s1c1
Sequence:CCGGCTGCATCAGAACCATGACGAACTCGAGTTCGTCATGGTTCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-392s1c1
Sequence:CCGGGCTGCTGACCAAAGAGGATTTCTCGAGAAATCCTCTTTGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-279s1c1
Sequence:CCGGCCGATTTACTGGAGCAGAGATCTCGAGATCTCTGCTCCAGTAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007961.2-1022s1c1
Sequence:CCGGCCTGGCTTACTTGAACCACATCTCGAGATGTGGTTCAAGTAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007961.3-4293s21c1
Sequence:CCGGTCGACATTAAAGCGACATTAACTCGAGTTAATGTCGCTTTAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-1112s21c1
Sequence:CCGGCAGTGTCTCCTGTCGAGAATACTCGAGTATTCTCGACAGGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-849s21c1
Sequence:CCGGTCAGAACCATGACGAAGATAACTCGAGTTATCTTCGTCATGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007961.3-425s21c1
Sequence:CCGGGCATTAAGCAGGAACGAATTTCTCGAGAAATTCGTTCCTGCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007961.3-562s21c1
Sequence:CCGGCTGCGTTTGCAGCCGATTTACCTCGAGGTAAATCGGCTGCAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks