EMAIL THIS PAGE TO A FRIEND

ETV7

ets variant 7

26 Gene Product Result for
Synonyms: TEL-2 TEL2 TELB
Gene ID:
Human(51513) Summary: The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721).[provided by RefSeq, May 2011]
Zebrafish(100009655) ets variant 7
domestic cat(101092271) ets variant 7
dog(481764) ets variant 7
chicken(419813) ets variant 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016135 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079741 MISSION® esiRNA esiRNA human ETV7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016135 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239852 predicted 812
2 SASI_Hs01_00239853 predicted 717
3 SASI_Hs01_00239854 predicted 217
4 SASI_Hs01_00239855 predicted 854
5 SASI_Hs01_00239856 predicted 1140
6 SASI_Hs01_00239857 predicted 851
7 SASI_Hs01_00239858 predicted 891
8 SASI_Hs02_00348932 predicted 862
9 SASI_Hs01_00239860 predicted 903
10 SASI_Hs01_00239861 predicted 1031
11 SASI_Hs01_00239859 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016135
ETV7 MISSION shRNA Bacterial Glycerol Stock
ets variant 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-906s21c1
Sequence:CCGGTTCCGAGTTGTGGATCCAAATCTCGAGATTTGGATCCACAACTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016135.2-1277s21c1
Sequence:CCGGGACTCTGTACCCACAGGATTACTCGAGTAATCCTGTGGGTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-823s21c1
Sequence:CCGGTGCTGTGGGATTACGTGTATCCTCGAGGATACACGTAATCCCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-706s21c1
Sequence:CCGGAGGAGGAGTCCCTCAACTTATCTCGAGATAAGTTGAGGGACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-226s1c1
Sequence:CCGGCCAGATGTGAAGCTCAAATTACTCGAGTAATTTGAGCTTCACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1057s1c1
Sequence:CCGGGATTTCTAAAGACTCCGGGAACTCGAGTTCCCGGAGTCTTTAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-846s1c1
Sequence:CCGGCTGCTCCTTGATACCCGATATCTCGAGATATCGGGTATCAAGGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1127s1c1
Sequence:CCGGGCAGGACAGAATAGAGTTCAACTCGAGTTGAACTCTATTCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-999s1c1
Sequence:CCGGCGCCACTATTATAAGCTTAATCTCGAGATTAAGCTTATAATAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016135
ETV7 MISSION shRNA shRNA Plasmid DNA
ets variant 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-906s21c1
Sequence:CCGGTTCCGAGTTGTGGATCCAAATCTCGAGATTTGGATCCACAACTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016135.2-1277s21c1
Sequence:CCGGGACTCTGTACCCACAGGATTACTCGAGTAATCCTGTGGGTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-823s21c1
Sequence:CCGGTGCTGTGGGATTACGTGTATCCTCGAGGATACACGTAATCCCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-706s21c1
Sequence:CCGGAGGAGGAGTCCCTCAACTTATCTCGAGATAAGTTGAGGGACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-226s1c1
Sequence:CCGGCCAGATGTGAAGCTCAAATTACTCGAGTAATTTGAGCTTCACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1057s1c1
Sequence:CCGGGATTTCTAAAGACTCCGGGAACTCGAGTTCCCGGAGTCTTTAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-846s1c1
Sequence:CCGGCTGCTCCTTGATACCCGATATCTCGAGATATCGGGTATCAAGGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1127s1c1
Sequence:CCGGGCAGGACAGAATAGAGTTCAACTCGAGTTGAACTCTATTCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-999s1c1
Sequence:CCGGCGCCACTATTATAAGCTTAATCTCGAGATTAAGCTTATAATAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016135
ETV7 MISSION shRNA Lentiviral Transduction Particles
ets variant 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-906s21c1
Sequence:CCGGTTCCGAGTTGTGGATCCAAATCTCGAGATTTGGATCCACAACTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016135.2-1277s21c1
Sequence:CCGGGACTCTGTACCCACAGGATTACTCGAGTAATCCTGTGGGTACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-823s21c1
Sequence:CCGGTGCTGTGGGATTACGTGTATCCTCGAGGATACACGTAATCCCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016135.2-706s21c1
Sequence:CCGGAGGAGGAGTCCCTCAACTTATCTCGAGATAAGTTGAGGGACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-226s1c1
Sequence:CCGGCCAGATGTGAAGCTCAAATTACTCGAGTAATTTGAGCTTCACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1057s1c1
Sequence:CCGGGATTTCTAAAGACTCCGGGAACTCGAGTTCCCGGAGTCTTTAGAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-846s1c1
Sequence:CCGGCTGCTCCTTGATACCCGATATCTCGAGATATCGGGTATCAAGGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-1127s1c1
Sequence:CCGGGCAGGACAGAATAGAGTTCAACTCGAGTTGAACTCTATTCTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016135.2-999s1c1
Sequence:CCGGCGCCACTATTATAAGCTTAATCTCGAGATTAAGCTTATAATAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks