EMAIL THIS PAGE TO A FRIEND

EVA1A

eva-1 homolog A (C. elegans)

102 Gene Product Result for
Synonyms: FAM176A TMEM166
UniProtKB ID: Q9H8M9, D6W5J3, Q9HC41
Gene ID:
Mouse(232146) eva-1 homolog A (C. elegans)
Rat(500221) eva-1 homolog A
Zebrafish(767647) eva-1 homolog A (C. elegans)
domestic guinea pig(100734992) eva-1 homolog A (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032181 Rosetta Predictions human pricing
NM_001109243 Rosetta Predictions rat pricing
NM_145570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114506 predicted 968
2 SASI_Hs01_00114507 predicted 712
3 SASI_Hs01_00114508 predicted 1078
4 SASI_Hs01_00114510 predicted 1304
5 SASI_Hs01_00114511 predicted 1335
6 SASI_Hs01_00114512 predicted 1279
7 SASI_Hs01_00114513 predicted 750
8 SASI_Hs01_00114514 predicted 1324
9 SASI_Hs01_00114515 predicted 910
10 SASI_Hs02_00359451 predicted 1317
11 SASI_Hs01_00114509 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246494 predicted 658
2 SASI_Rn02_00246495 predicted 654
3 SASI_Rn02_00246496 predicted 787
4 SASI_Rn02_00246497 predicted 732
5 SASI_Rn02_00246498 predicted 826
6 SASI_Rn02_00246499 predicted 897
7 SASI_Rn02_00246500 predicted 934
8 SASI_Rn02_00246501 predicted 716
9 SASI_Rn02_00246502 predicted 383
10 SASI_Rn02_00246503 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341081 predicted 901
2 SASI_Mm01_00074087 predicted 751
3 SASI_Mm02_00341082 predicted 985
4 SASI_Mm01_00074088 predicted 669
5 SASI_Mm01_00074089 predicted 811
6 SASI_Mm02_00341083 predicted 918
7 SASI_Mm01_00074091 predicted 504
8 SASI_Mm01_00074092 predicted 686
9 SASI_Mm01_00074093 predicted 702
10 SASI_Mm02_00341084 predicted 898
11 SASI_Mm01_00074086 predicted 861
12 SASI_Mm01_00074090 predicted 634
13 SASI_Mm01_00074094 predicted 765
14 SASI_Mm01_00074095 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032181
VALIDATED
EVA1A MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog A (C. elegans)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-477s1c1
Sequence:CCGGGATGGCTTTGCTCAGCAACATCTCGAGATGTTGCTGAGCAAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-536s1c1
Sequence:CCGGGAGCAGCTCTGTACTTTGTTTCTCGAGAAACAAAGTACAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1168s1c1
Sequence:CCGGCGACTGTGGTTTCTCTTGATTCTCGAGAATCAAGAGAAACCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-506s1c1
Sequence:CCGGCCTATTCCTTTGTCTCAGAAACTCGAGTTTCTGAGACAAAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1280s1c1
Sequence:CCGGGCAGGGTGAACTTAACCCAATCTCGAGATTGGGTTAAGTTCACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-876s1c1
Sequence:CCGGGAGCCTGAATCGCTACTATTACTCGAGTAATAGTAGCGATTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-549s1c1
Sequence:CCGGCTTTGTTTCTGGCGTGTGCATCTCGAGATGCACACGCCAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-1146s21c1
Sequence:CCGGGTGGATGGAGATCGGAGAAACCTCGAGGTTTCTCCGATCTCCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-491s21c1
Sequence:CCGGGCAACATCCTAGCGGCCTATTCTCGAGAATAGGCCGCTAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032181.2-593s21c1
Sequence:CCGGCTCTGGTGATAAGGATCTCTTCTCGAGAAGAGATCCTTATCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-976s21c1
Sequence:CCGGGAACCCAGCTCTGCTAATATTCTCGAGAATATTAGCAGAGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-533s21c1
Sequence:CCGGAGCGAGCAGCTCTGTACTTTGCTCGAGCAAAGTACAGAGCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-821s21c1
Sequence:CCGGAGCGCATCATCAGGGAGATCTCTCGAGAGATCTCCCTGATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032181
VALIDATED
EVA1A MISSION shRNA shRNA Plasmid DNA
eva-1 homolog A (C. elegans)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-477s1c1
Sequence:CCGGGATGGCTTTGCTCAGCAACATCTCGAGATGTTGCTGAGCAAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-536s1c1
Sequence:CCGGGAGCAGCTCTGTACTTTGTTTCTCGAGAAACAAAGTACAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1168s1c1
Sequence:CCGGCGACTGTGGTTTCTCTTGATTCTCGAGAATCAAGAGAAACCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-506s1c1
Sequence:CCGGCCTATTCCTTTGTCTCAGAAACTCGAGTTTCTGAGACAAAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1280s1c1
Sequence:CCGGGCAGGGTGAACTTAACCCAATCTCGAGATTGGGTTAAGTTCACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-876s1c1
Sequence:CCGGGAGCCTGAATCGCTACTATTACTCGAGTAATAGTAGCGATTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-549s1c1
Sequence:CCGGCTTTGTTTCTGGCGTGTGCATCTCGAGATGCACACGCCAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-1146s21c1
Sequence:CCGGGTGGATGGAGATCGGAGAAACCTCGAGGTTTCTCCGATCTCCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-491s21c1
Sequence:CCGGGCAACATCCTAGCGGCCTATTCTCGAGAATAGGCCGCTAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032181.2-593s21c1
Sequence:CCGGCTCTGGTGATAAGGATCTCTTCTCGAGAAGAGATCCTTATCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-976s21c1
Sequence:CCGGGAACCCAGCTCTGCTAATATTCTCGAGAATATTAGCAGAGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-533s21c1
Sequence:CCGGAGCGAGCAGCTCTGTACTTTGCTCGAGCAAAGTACAGAGCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-821s21c1
Sequence:CCGGAGCGCATCATCAGGGAGATCTCTCGAGAGATCTCCCTGATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032181
VALIDATED
EVA1A MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog A (C. elegans)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-477s1c1
Sequence:CCGGGATGGCTTTGCTCAGCAACATCTCGAGATGTTGCTGAGCAAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032181.1-536s1c1
Sequence:CCGGGAGCAGCTCTGTACTTTGTTTCTCGAGAAACAAAGTACAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1168s1c1
Sequence:CCGGCGACTGTGGTTTCTCTTGATTCTCGAGAATCAAGAGAAACCACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-506s1c1
Sequence:CCGGCCTATTCCTTTGTCTCAGAAACTCGAGTTTCTGAGACAAAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032181.1-1280s1c1
Sequence:CCGGGCAGGGTGAACTTAACCCAATCTCGAGATTGGGTTAAGTTCACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-876s1c1
Sequence:CCGGGAGCCTGAATCGCTACTATTACTCGAGTAATAGTAGCGATTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032181.1-549s1c1
Sequence:CCGGCTTTGTTTCTGGCGTGTGCATCTCGAGATGCACACGCCAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-1146s21c1
Sequence:CCGGGTGGATGGAGATCGGAGAAACCTCGAGGTTTCTCCGATCTCCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-491s21c1
Sequence:CCGGGCAACATCCTAGCGGCCTATTCTCGAGAATAGGCCGCTAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032181.2-593s21c1
Sequence:CCGGCTCTGGTGATAAGGATCTCTTCTCGAGAAGAGATCCTTATCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-976s21c1
Sequence:CCGGGAACCCAGCTCTGCTAATATTCTCGAGAATATTAGCAGAGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-533s21c1
Sequence:CCGGAGCGAGCAGCTCTGTACTTTGCTCGAGCAAAGTACAGAGCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032181.2-821s21c1
Sequence:CCGGAGCGCATCATCAGGGAGATCTCTCGAGAGATCTCCCTGATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145570
EVA1A MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog A (C. elegans)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-710s1c1
Sequence:CCGGCGAACGAATCATCAGGGAGATCTCGAGATCTCCCTGATGATTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-443s1c1
Sequence:CCGGCTTTGTCTCTGGAGTGTGCATCTCGAGATGCACACTCCAGAGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-767s1c1
Sequence:CCGGGAGCCTGAACCGATACTACTACTCGAGTAGTAGTATCGGTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145570.1-1133s1c1
Sequence:CCGGGCAGACTTATCCTGTGCTATTCTCGAGAATAGCACAGGATAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-399s1c1
Sequence:CCGGGCCTGGTCTTATATCTCAGAACTCGAGTTCTGAGATATAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-644s1c1
Sequence:CCGGGACTTTGAATAAGAACGTGTTCTCGAGAACACGTTCTTATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.1-1143s1c1
Sequence:CCGGCCTGTGCTATTATTCCTTTATCTCGAGATAAAGGAATAATAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1156s21c1
Sequence:CCGGTCCGAAGCGCTCAGAAGTTTGCTCGAGCAAACTTCTGAGCGCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.2-1490s1c1
Sequence:CCGGGACTTAGGATACATCAATAACCTCGAGGTTATTGATGTATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1025s21c1
Sequence:CCGGGGCAGTGGCATCTACTCTTTCCTCGAGGAAAGAGTAGATGCCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1131s21c1
Sequence:CCGGAGCGATGGGACAAGCTGAAAGCTCGAGCTTTCAGCTTGTCCCATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-532s21c1
Sequence:CCGGCCTTGGTGATGAGGATCTCCTCTCGAGAGGAGATCCTCATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-500s21c1
Sequence:CCGGAGTGTGCATTGGCCTGTTCCTCTCGAGAGGAACAGGCCAATGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-473s21c1
Sequence:CCGGGCGAGCCGCTCTGTACTTTGTCTCGAGACAAAGTACAGAGCGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145570
EVA1A MISSION shRNA shRNA Plasmid DNA
eva-1 homolog A (C. elegans)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-710s1c1
Sequence:CCGGCGAACGAATCATCAGGGAGATCTCGAGATCTCCCTGATGATTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-443s1c1
Sequence:CCGGCTTTGTCTCTGGAGTGTGCATCTCGAGATGCACACTCCAGAGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-767s1c1
Sequence:CCGGGAGCCTGAACCGATACTACTACTCGAGTAGTAGTATCGGTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145570.1-1133s1c1
Sequence:CCGGGCAGACTTATCCTGTGCTATTCTCGAGAATAGCACAGGATAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-399s1c1
Sequence:CCGGGCCTGGTCTTATATCTCAGAACTCGAGTTCTGAGATATAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-644s1c1
Sequence:CCGGGACTTTGAATAAGAACGTGTTCTCGAGAACACGTTCTTATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.1-1143s1c1
Sequence:CCGGCCTGTGCTATTATTCCTTTATCTCGAGATAAAGGAATAATAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1156s21c1
Sequence:CCGGTCCGAAGCGCTCAGAAGTTTGCTCGAGCAAACTTCTGAGCGCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.2-1490s1c1
Sequence:CCGGGACTTAGGATACATCAATAACCTCGAGGTTATTGATGTATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1025s21c1
Sequence:CCGGGGCAGTGGCATCTACTCTTTCCTCGAGGAAAGAGTAGATGCCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1131s21c1
Sequence:CCGGAGCGATGGGACAAGCTGAAAGCTCGAGCTTTCAGCTTGTCCCATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-532s21c1
Sequence:CCGGCCTTGGTGATGAGGATCTCCTCTCGAGAGGAGATCCTCATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-500s21c1
Sequence:CCGGAGTGTGCATTGGCCTGTTCCTCTCGAGAGGAACAGGCCAATGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-473s21c1
Sequence:CCGGGCGAGCCGCTCTGTACTTTGTCTCGAGACAAAGTACAGAGCGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145570
EVA1A MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog A (C. elegans)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-710s1c1
Sequence:CCGGCGAACGAATCATCAGGGAGATCTCGAGATCTCCCTGATGATTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145570.1-443s1c1
Sequence:CCGGCTTTGTCTCTGGAGTGTGCATCTCGAGATGCACACTCCAGAGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-767s1c1
Sequence:CCGGGAGCCTGAACCGATACTACTACTCGAGTAGTAGTATCGGTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145570.1-1133s1c1
Sequence:CCGGGCAGACTTATCCTGTGCTATTCTCGAGAATAGCACAGGATAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-399s1c1
Sequence:CCGGGCCTGGTCTTATATCTCAGAACTCGAGTTCTGAGATATAAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145570.1-644s1c1
Sequence:CCGGGACTTTGAATAAGAACGTGTTCTCGAGAACACGTTCTTATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.1-1143s1c1
Sequence:CCGGCCTGTGCTATTATTCCTTTATCTCGAGATAAAGGAATAATAGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1156s21c1
Sequence:CCGGTCCGAAGCGCTCAGAAGTTTGCTCGAGCAAACTTCTGAGCGCTTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145570.2-1490s1c1
Sequence:CCGGGACTTAGGATACATCAATAACCTCGAGGTTATTGATGTATCCTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1025s21c1
Sequence:CCGGGGCAGTGGCATCTACTCTTTCCTCGAGGAAAGAGTAGATGCCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145570.2-1131s21c1
Sequence:CCGGAGCGATGGGACAAGCTGAAAGCTCGAGCTTTCAGCTTGTCCCATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-532s21c1
Sequence:CCGGCCTTGGTGATGAGGATCTCCTCTCGAGAGGAGATCCTCATCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-500s21c1
Sequence:CCGGAGTGTGCATTGGCCTGTTCCTCTCGAGAGGAACAGGCCAATGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145570.2-473s21c1
Sequence:CCGGGCGAGCCGCTCTGTACTTTGTCTCGAGACAAAGTACAGAGCGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks