EMAIL THIS PAGE TO A FRIEND

EVA1B

eva-1 homolog B (C. elegans)

51 Gene Product Result for
Synonyms: C1orf78 FAM176B RP11-268J15.2
UniProtKB ID: Q9NVM1, D3DPS7
Gene ID:
Mouse(230752) eva-1 homolog B (C. elegans)
Rat(362597) eva-1 homolog B
sheep(101117555) eva-1 homolog B (C. elegans)
domestic guinea pig(100729176) eva-1 homolog B (C. elegans)
naked mole-rat(101721254) eva-1 homolog B (C. elegans)
chicken(101666722) eva-1 homolog B (C. elegans)
chicken(101749609) eva-1 homolog B (C. elegans)
dog(608469) eva-1 homolog B (C. elegans)
cow(618094) eva-1 homolog B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018166 Rosetta Predictions human pricing
NM_001108679 Rosetta Predictions rat pricing
NM_172145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092657 predicted 767
2 SASI_Hs01_00092658 predicted 764
3 SASI_Hs01_00092659 predicted 761
4 SASI_Hs01_00092661 predicted 763
5 SASI_Hs01_00092662 predicted 755
6 SASI_Hs01_00092663 predicted 820
7 SASI_Hs01_00092664 predicted 819
8 SASI_Hs01_00092665 predicted 827
9 SASI_Hs01_00092666 predicted 755
10 SASI_Hs02_00351417 predicted 760
11 SASI_Hs01_00092660 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241005 predicted 509
2 SASI_Rn02_00241006 predicted 460
3 SASI_Rn02_00241007 predicted 371
4 SASI_Rn02_00241008 predicted 707
5 SASI_Rn02_00241009 predicted 770
6 SASI_Rn02_00241010 predicted 236
7 SASI_Rn02_00241011 predicted 844
8 SASI_Rn02_00241012 predicted 844
9 SASI_Rn02_00241013 predicted 808
10 SASI_Rn02_00241014 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141041 predicted 783
2 SASI_Mm02_00343683 predicted 1113
3 SASI_Mm01_00141042 predicted 872
4 SASI_Mm02_00343684 predicted 926
5 SASI_Mm01_00141043 predicted 1038
6 SASI_Mm02_00343685 predicted 1120
7 SASI_Mm01_00141044 predicted 977
8 SASI_Mm02_00343686 predicted 697
9 SASI_Mm01_00141045 predicted 1125
10 SASI_Mm01_00141046 predicted 781
11 SASI_Mm01_00141040 predicted 732
12 SASI_Mm01_00141047 predicted 998
13 SASI_Mm01_00141048 predicted 1052
14 SASI_Mm01_00141049 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018166
EVA1B MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog B (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-367s21c1
Sequence:CCGGCGAGAGCTTTGGCCTCTACTTCTCGAGAAGTAGAGGCCAAAGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018166.1-829s21c1
Sequence:CCGGGACCTGTACATGAGCTCAGAGCTCGAGCTCTGAGCTCATGTACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-429s21c1
Sequence:CCGGTGCTCGTCATCAGCATCTCGTCTCGAGACGAGATGCTGATGACGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-771s21c1
Sequence:CCGGGCCGCATGCACTATTACTGATCTCGAGATCAGTAATAGTGCATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-612s21c1
Sequence:CCGGCCCTCAACGTCAACGTCTTCACTCGAGTGAAGACGTTGACGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018166
EVA1B MISSION shRNA shRNA Plasmid DNA
eva-1 homolog B (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-367s21c1
Sequence:CCGGCGAGAGCTTTGGCCTCTACTTCTCGAGAAGTAGAGGCCAAAGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018166.1-829s21c1
Sequence:CCGGGACCTGTACATGAGCTCAGAGCTCGAGCTCTGAGCTCATGTACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-429s21c1
Sequence:CCGGTGCTCGTCATCAGCATCTCGTCTCGAGACGAGATGCTGATGACGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-771s21c1
Sequence:CCGGGCCGCATGCACTATTACTGATCTCGAGATCAGTAATAGTGCATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-612s21c1
Sequence:CCGGCCCTCAACGTCAACGTCTTCACTCGAGTGAAGACGTTGACGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018166
EVA1B MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog B (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-367s21c1
Sequence:CCGGCGAGAGCTTTGGCCTCTACTTCTCGAGAAGTAGAGGCCAAAGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018166.1-829s21c1
Sequence:CCGGGACCTGTACATGAGCTCAGAGCTCGAGCTCTGAGCTCATGTACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-429s21c1
Sequence:CCGGTGCTCGTCATCAGCATCTCGTCTCGAGACGAGATGCTGATGACGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-771s21c1
Sequence:CCGGGCCGCATGCACTATTACTGATCTCGAGATCAGTAATAGTGCATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018166.1-612s21c1
Sequence:CCGGCCCTCAACGTCAACGTCTTCACTCGAGTGAAGACGTTGACGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172145
VALIDATED
EVA1B MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1175s21c1
Sequence:CCGGCCAGAGTACTGGATATGGGACCTCGAGGTCCCATATCCAGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1044s21c1
Sequence:CCGGTGAACGAATCCTGCGGGAGATCTCGAGATCTCCCGCAGGATTCGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172145.3-1128s21c1
Sequence:CCGGGCTGGGACGAATGCACTATTACTCGAGTAATAGTGCATTCGTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-709s21c1
Sequence:CCGGTATGCGCACATCAGAGCTAACCTCGAGGTTAGCTCTGATGTGCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-980s21c1
Sequence:CCGGCCCTTAGTGTCAATGTCTTCACTCGAGTGAAGACATTGACACTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172145
VALIDATED
EVA1B MISSION shRNA shRNA Plasmid DNA
eva-1 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1175s21c1
Sequence:CCGGCCAGAGTACTGGATATGGGACCTCGAGGTCCCATATCCAGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1044s21c1
Sequence:CCGGTGAACGAATCCTGCGGGAGATCTCGAGATCTCCCGCAGGATTCGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172145.3-1128s21c1
Sequence:CCGGGCTGGGACGAATGCACTATTACTCGAGTAATAGTGCATTCGTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-709s21c1
Sequence:CCGGTATGCGCACATCAGAGCTAACCTCGAGGTTAGCTCTGATGTGCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-980s21c1
Sequence:CCGGCCCTTAGTGTCAATGTCTTCACTCGAGTGAAGACATTGACACTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172145
VALIDATED
EVA1B MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog B (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1175s21c1
Sequence:CCGGCCAGAGTACTGGATATGGGACCTCGAGGTCCCATATCCAGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-1044s21c1
Sequence:CCGGTGAACGAATCCTGCGGGAGATCTCGAGATCTCCCGCAGGATTCGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172145.3-1128s21c1
Sequence:CCGGGCTGGGACGAATGCACTATTACTCGAGTAATAGTGCATTCGTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-709s21c1
Sequence:CCGGTATGCGCACATCAGAGCTAACCTCGAGGTTAGCTCTGATGTGCGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172145.3-980s21c1
Sequence:CCGGCCCTTAGTGTCAATGTCTTCACTCGAGTGAAGACATTGACACTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)