EMAIL THIS PAGE TO A FRIEND

EVA1C

eva-1 homolog C (C. elegans)

152 Gene Product Result for
Synonyms: B18 B19 C21orf63 C21orf64 FAM176C SUE21
UniProtKB ID: P58658, Q8IXZ0
Gene ID:
Mouse(70967) eva-1 homolog C (C. elegans)
Rat(360695) eva-1 homolog C
Zebrafish(564385) eva-1 homolog C (C. elegans)
dog(478402) eva-1 homolog C (C. elegans)
cow(516536) eva-1 homolog C (C. elegans)
naked mole-rat(101717151) eva-1 homolog C (C. elegans)
domestic guinea pig(100716903) eva-1 homolog C (C. elegans)
sheep(101102355) eva-1 homolog C (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149271 MISSION® esiRNA esiRNA targeting mouse 4931408A02Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058187 Rosetta Predictions human pricing
XM_001073261 Rosetta Predictions rat pricing
XM_340966 Rosetta Predictions rat pricing
NM_027627 Rosetta Predictions mouse pricing
XM_354970 Rosetta Predictions mouse pricing
XM_896817 Rosetta Predictions mouse pricing
XM_896825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040518 predicted 1049
2 SASI_Hs01_00040519 predicted 1034
3 SASI_Hs02_00362111 predicted 1665
4 SASI_Hs01_00040520 predicted 1641
5 SASI_Hs01_00040522 predicted 557
6 SASI_Hs02_00362112 predicted 869
7 SASI_Hs01_00040523 predicted 865
8 SASI_Hs01_00040524 predicted 831
9 SASI_Hs01_00040525 predicted 1710
10 SASI_Hs01_00040526 predicted 1643
11 SASI_Hs01_00040517 predicted 1179
12 SASI_Hs01_00040521 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342122 predicted 1670
2 SASI_Rn02_00342123 predicted 1632
3 SASI_Rn02_00342124 predicted 1022
4 SASI_Rn02_00342125 predicted 793
5 SASI_Rn02_00342126 predicted 1470
6 SASI_Rn02_00342127 predicted 1228
7 SASI_Rn02_00342128 predicted 1565
8 SASI_Rn02_00342129 predicted 445
9 SASI_Rn02_00342130 predicted 798
10 SASI_Rn02_00342131 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392190 predicted 748
2 SASI_Rn02_00392191 predicted 801
3 SASI_Rn02_00392192 predicted 1023
4 SASI_Rn02_00392193 predicted 1018
5 SASI_Rn02_00392194 predicted 868
6 SASI_Rn02_00392195 predicted 1092
7 SASI_Rn02_00392196 predicted 797
8 SASI_Rn02_00392197 predicted 440
9 SASI_Rn02_00392198 predicted 445
10 SASI_Rn02_00392199 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332489 predicted 871
2 SASI_Mm02_00332490 predicted 1319
3 SASI_Mm02_00332491 predicted 617
4 SASI_Mm02_00332492 predicted 697
5 SASI_Mm02_00332493 predicted 1029
6 SASI_Mm02_00332494 predicted 270
7 SASI_Mm02_00332495 predicted 902
8 SASI_Mm02_00332496 predicted 829
9 SASI_Mm02_00332497 predicted 789
10 SASI_Mm02_00332498 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263385 predicted 739
2 SASI_Mm01_00263386 predicted 480
3 SASI_Mm01_00263387 predicted 479
4 SASI_Mm01_00263388 predicted 638
5 SASI_Mm01_00263389 predicted 421
6 SASI_Mm01_00263390 predicted 444
7 SASI_Mm01_00263391 predicted 441
8 SASI_Mm01_00263392 predicted 428
9 SASI_Mm01_00263393 predicted 479
10 SASI_Mm01_00263394 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275322 predicted 1056
2 SASI_Mm01_00275323 predicted 855
3 SASI_Mm01_00275324 predicted 822
4 SASI_Mm01_00275325 predicted 881
5 SASI_Mm01_00275326 predicted 877
6 SASI_Mm01_00275327 predicted 948
7 SASI_Mm01_00275328 predicted 936
8 SASI_Mm01_00275329 predicted 947
9 SASI_Mm01_00275330 predicted 871
10 SASI_Mm01_00275331 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263600 predicted 1483
2 SASI_Mm01_00263601 predicted 740
3 SASI_Mm01_00263602 predicted 1500
4 SASI_Mm01_00263603 predicted 478
5 SASI_Mm01_00263604 predicted 638
6 SASI_Mm01_00263605 predicted 417
7 SASI_Mm01_00263606 predicted 1202
8 SASI_Mm01_00263607 predicted 445
9 SASI_Mm01_00263608 predicted 1429
10 SASI_Mm01_00263609 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058187
VALIDATED
EVA1C MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog C (C. elegans)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1807s21c1
Sequence:CCGGGTTCACCTGTACCTTCTATGACTCGAGTCATAGAAGGTACAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-634s21c1
Sequence:CCGGTACAGTGCCCTCGGCATTCTACTCGAGTAGAATGCCGAGGGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1771s21c1
Sequence:CCGGGAAGAAGGAAGGATCCCAAATCTCGAGATTTGGGATCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-1646s21c1
Sequence:CCGGGATTGAGCGCAGGGAGCAAATCTCGAGATTTGCTCCCTGCGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1748s21c1
Sequence:CCGGATCTTGATGCGATCGCACTTTCTCGAGAAAGTGCGATCGCATCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-842s21c1
Sequence:CCGGTTGTCCAGGAAGCAGTAAATACTCGAGTATTTACTGCTTCCTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1815s1c1
Sequence:CCGGGTACCTTCTATGAAGGAGAATCTCGAGATTCTCCTTCATAGAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058187.3-1181s1c1
Sequence:CCGGCGCATGTGTTCCCAAGAACATCTCGAGATGTTCTTGGGAACACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1801s1c1
Sequence:CCGGGTTCTGGTTCACCTGTACCTTCTCGAGAAGGTACAGGTGAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-944s1c1
Sequence:CCGGCCATGAATCCAAGTTCCTCAACTCGAGTTGAGGAACTTGGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1239s1c1
Sequence:CCGGCCTTCTTTGAAGCAGAAAGATCTCGAGATCTTTCTGCTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1037s1c1
Sequence:CCGGCCCTTTCGATTGCTTGTCTTACTCGAGTAAGACAAGCAATCGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058187.3-1112s1c1
Sequence:CCGGCATCGTCAACAATCACCATTTCTCGAGAAATGGTGATTGTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058187
VALIDATED
EVA1C MISSION shRNA shRNA Plasmid DNA
eva-1 homolog C (C. elegans)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1807s21c1
Sequence:CCGGGTTCACCTGTACCTTCTATGACTCGAGTCATAGAAGGTACAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-634s21c1
Sequence:CCGGTACAGTGCCCTCGGCATTCTACTCGAGTAGAATGCCGAGGGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1771s21c1
Sequence:CCGGGAAGAAGGAAGGATCCCAAATCTCGAGATTTGGGATCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-1646s21c1
Sequence:CCGGGATTGAGCGCAGGGAGCAAATCTCGAGATTTGCTCCCTGCGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1748s21c1
Sequence:CCGGATCTTGATGCGATCGCACTTTCTCGAGAAAGTGCGATCGCATCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-842s21c1
Sequence:CCGGTTGTCCAGGAAGCAGTAAATACTCGAGTATTTACTGCTTCCTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1815s1c1
Sequence:CCGGGTACCTTCTATGAAGGAGAATCTCGAGATTCTCCTTCATAGAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058187.3-1181s1c1
Sequence:CCGGCGCATGTGTTCCCAAGAACATCTCGAGATGTTCTTGGGAACACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1801s1c1
Sequence:CCGGGTTCTGGTTCACCTGTACCTTCTCGAGAAGGTACAGGTGAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-944s1c1
Sequence:CCGGCCATGAATCCAAGTTCCTCAACTCGAGTTGAGGAACTTGGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1239s1c1
Sequence:CCGGCCTTCTTTGAAGCAGAAAGATCTCGAGATCTTTCTGCTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1037s1c1
Sequence:CCGGCCCTTTCGATTGCTTGTCTTACTCGAGTAAGACAAGCAATCGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058187.3-1112s1c1
Sequence:CCGGCATCGTCAACAATCACCATTTCTCGAGAAATGGTGATTGTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058187
VALIDATED
EVA1C MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog C (C. elegans)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1807s21c1
Sequence:CCGGGTTCACCTGTACCTTCTATGACTCGAGTCATAGAAGGTACAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-634s21c1
Sequence:CCGGTACAGTGCCCTCGGCATTCTACTCGAGTAGAATGCCGAGGGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1771s21c1
Sequence:CCGGGAAGAAGGAAGGATCCCAAATCTCGAGATTTGGGATCCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-1646s21c1
Sequence:CCGGGATTGAGCGCAGGGAGCAAATCTCGAGATTTGCTCCCTGCGCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058187.3-1748s21c1
Sequence:CCGGATCTTGATGCGATCGCACTTTCTCGAGAAAGTGCGATCGCATCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058187.3-842s21c1
Sequence:CCGGTTGTCCAGGAAGCAGTAAATACTCGAGTATTTACTGCTTCCTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1815s1c1
Sequence:CCGGGTACCTTCTATGAAGGAGAATCTCGAGATTCTCCTTCATAGAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058187.3-1181s1c1
Sequence:CCGGCGCATGTGTTCCCAAGAACATCTCGAGATGTTCTTGGGAACACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058187.3-1801s1c1
Sequence:CCGGGTTCTGGTTCACCTGTACCTTCTCGAGAAGGTACAGGTGAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-944s1c1
Sequence:CCGGCCATGAATCCAAGTTCCTCAACTCGAGTTGAGGAACTTGGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1239s1c1
Sequence:CCGGCCTTCTTTGAAGCAGAAAGATCTCGAGATCTTTCTGCTTCAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_058187.3-1037s1c1
Sequence:CCGGCCCTTTCGATTGCTTGTCTTACTCGAGTAAGACAAGCAATCGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058187.3-1112s1c1
Sequence:CCGGCATCGTCAACAATCACCATTTCTCGAGAAATGGTGATTGTTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027627
EVA1C MISSION shRNA Bacterial Glycerol Stock
eva-1 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-850s21c1
Sequence:CCGGTCTGAAGAAAGATGATGAACACTCGAGTGTTCATCATCTTTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-823s21c1
Sequence:CCGGTCCGGCTGTTGCTAATCTAAACTCGAGTTTAGATTAGCAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-863s21c1
Sequence:CCGGGATGAACACGGTATAACATTCCTCGAGGAATGTTATACCGTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-831s21c1
Sequence:CCGGTTGCTAATCTAAATCCTTCTCCTCGAGGAGAAGGATTTAGATTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-789s21c1
Sequence:CCGGCCTTCGTTCCCAAGAACATACCTCGAGGTATGTTCTTGGGAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027627
EVA1C MISSION shRNA shRNA Plasmid DNA
eva-1 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-850s21c1
Sequence:CCGGTCTGAAGAAAGATGATGAACACTCGAGTGTTCATCATCTTTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-823s21c1
Sequence:CCGGTCCGGCTGTTGCTAATCTAAACTCGAGTTTAGATTAGCAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-863s21c1
Sequence:CCGGGATGAACACGGTATAACATTCCTCGAGGAATGTTATACCGTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-831s21c1
Sequence:CCGGTTGCTAATCTAAATCCTTCTCCTCGAGGAGAAGGATTTAGATTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-789s21c1
Sequence:CCGGCCTTCGTTCCCAAGAACATACCTCGAGGTATGTTCTTGGGAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027627
EVA1C MISSION shRNA Lentiviral Transduction Particles
eva-1 homolog C (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-850s21c1
Sequence:CCGGTCTGAAGAAAGATGATGAACACTCGAGTGTTCATCATCTTTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-823s21c1
Sequence:CCGGTCCGGCTGTTGCTAATCTAAACTCGAGTTTAGATTAGCAACAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-863s21c1
Sequence:CCGGGATGAACACGGTATAACATTCCTCGAGGAATGTTATACCGTGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-831s21c1
Sequence:CCGGTTGCTAATCTAAATCCTTCTCCTCGAGGAGAAGGATTTAGATTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027627.1-789s21c1
Sequence:CCGGCCTTCGTTCCCAAGAACATACCTCGAGGTATGTTCTTGGGAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks