EMAIL THIS PAGE TO A FRIEND

EVC2

Ellis van Creveld syndrome 2

61 Gene Product Result for
Synonyms: LBN
UniProtKB ID: Q86UK5, Q86YT3, Q86YT4, Q8NG49
Gene ID:
Human(132884) Summary: This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(68525) Ellis van Creveld syndrome 2
Rat(289711) Ellis van Creveld syndrome 2
chicken(770095) Ellis van Creveld syndrome 2
dog(611156) Ellis van Creveld syndrome 2
cow(280834) Ellis van Creveld syndrome 2
domestic cat(101092761) Ellis van Creveld syndrome 2
naked mole-rat(101718549) Ellis van Creveld syndrome 2
domestic guinea pig(100731709) Ellis van Creveld syndrome 2
sheep(101102904) Ellis van Creveld syndrome 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147127 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147127 Rosetta Predictions human pricing
NM_001106012 Rosetta Predictions rat pricing
NM_145920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140148 predicted 284
2 SASI_Hs02_00365466 predicted 1770
3 SASI_Hs02_00365467 predicted 382
4 SASI_Hs01_00140151 predicted 3701
5 SASI_Hs02_00365468 predicted 1581
6 SASI_Hs01_00140153 predicted 2069
7 SASI_Hs01_00140154 predicted 1822
8 SASI_Hs01_00140155 predicted 3080
9 SASI_Hs01_00140156 predicted 1795
10 SASI_Hs02_00365469 predicted 2889
11 SASI_Hs01_00140147 predicted 1835
12 SASI_Hs01_00140149 predicted 1132
13 SASI_Hs01_00140150 predicted 2021
14 SASI_Hs01_00140152 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214752 predicted 1642
2 SASI_Rn02_00214753 predicted 1680
3 SASI_Rn02_00214754 predicted 3423
4 SASI_Rn02_00214755 predicted 3563
5 SASI_Rn02_00214756 predicted 621
6 SASI_Rn02_00214757 predicted 440
7 SASI_Rn02_00214758 predicted 2505
8 SASI_Rn02_00214759 predicted 979
9 SASI_Rn02_00214760 predicted 1799
10 SASI_Rn02_00214761 predicted 2725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106976 predicted 2653
2 SASI_Mm01_00106977 predicted 450
3 SASI_Mm01_00106978 predicted 1747
4 SASI_Mm01_00106979 predicted 468
5 SASI_Mm01_00106980 predicted 1495
6 SASI_Mm01_00106981 predicted 3343
7 SASI_Mm01_00106983 predicted 775
8 SASI_Mm01_00106984 predicted 460
9 SASI_Mm02_00341373 predicted 1671
10 SASI_Mm01_00106985 predicted 965
11 SASI_Mm01_00106982 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145920
EVC2 MISSION shRNA Bacterial Glycerol Stock
Ellis van Creveld syndrome 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145920.2-3903s1c1
Sequence:CCGGCCTTCCTTCTAAGTCCGTATTCTCGAGAATACGGACTTAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-982s1c1
Sequence:CCGGCAGATTAGTAAGGACATCATTCTCGAGAATGATGTCCTTACTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145920.2-1750s1c1
Sequence:CCGGGACAATGACTTAAAGCAGGAACTCGAGTTCCTGCTTTAAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-433s1c1
Sequence:CCGGCCTGGAAATAATACTCAGGATCTCGAGATCCTGAGTATTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-432s1c1
Sequence:CCGGGCCTGGAAATAATACTCAGGACTCGAGTCCTGAGTATTATTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-459s1c1
Sequence:CCGGCCAGACTTTCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145920.2-3802s1c1
Sequence:CCGGGCTTGCAGTATACATATGCTTCTCGAGAAGCATATGTATACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145920
EVC2 MISSION shRNA shRNA Plasmid DNA
Ellis van Creveld syndrome 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145920.2-3903s1c1
Sequence:CCGGCCTTCCTTCTAAGTCCGTATTCTCGAGAATACGGACTTAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-982s1c1
Sequence:CCGGCAGATTAGTAAGGACATCATTCTCGAGAATGATGTCCTTACTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145920.2-1750s1c1
Sequence:CCGGGACAATGACTTAAAGCAGGAACTCGAGTTCCTGCTTTAAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-433s1c1
Sequence:CCGGCCTGGAAATAATACTCAGGATCTCGAGATCCTGAGTATTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-432s1c1
Sequence:CCGGGCCTGGAAATAATACTCAGGACTCGAGTCCTGAGTATTATTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-459s1c1
Sequence:CCGGCCAGACTTTCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145920.2-3802s1c1
Sequence:CCGGGCTTGCAGTATACATATGCTTCTCGAGAAGCATATGTATACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145920
EVC2 MISSION shRNA Lentiviral Transduction Particles
Ellis van Creveld syndrome 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145920.2-3903s1c1
Sequence:CCGGCCTTCCTTCTAAGTCCGTATTCTCGAGAATACGGACTTAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-982s1c1
Sequence:CCGGCAGATTAGTAAGGACATCATTCTCGAGAATGATGTCCTTACTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145920.2-1750s1c1
Sequence:CCGGGACAATGACTTAAAGCAGGAACTCGAGTTCCTGCTTTAAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-433s1c1
Sequence:CCGGCCTGGAAATAATACTCAGGATCTCGAGATCCTGAGTATTATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-432s1c1
Sequence:CCGGGCCTGGAAATAATACTCAGGACTCGAGTCCTGAGTATTATTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145920.2-459s1c1
Sequence:CCGGCCAGACTTTCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145920.2-3802s1c1
Sequence:CCGGGCTTGCAGTATACATATGCTTCTCGAGAAGCATATGTATACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147127
EVC2 MISSION shRNA Bacterial Glycerol Stock
Ellis van Creveld syndrome 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4267s1c1
Sequence:CCGGGCAGAAACCATTGATCTATTACTCGAGTAATAGATCAATGGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-922s1c1
Sequence:CCGGCCTATAACACACCGCCTGTATCTCGAGATACAGGCGGTGTGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4171s1c1
Sequence:CCGGCCTCTCAGAGAGAGGATGATACTCGAGTATCATCCTCTCTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-1560s1c1
Sequence:CCGGCCTTTCCCTTAACGACCAAATCTCGAGATTTGGTCGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147127.4-1052s21c1
Sequence:CCGGGACATCGGGTTTGGCAGTATGCTCGAGCATACTGCCAAACCCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147127.4-4179s21c1
Sequence:CCGGCCATATCACAAGGACATAAACCTCGAGGTTTATGTCCTTGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147127
EVC2 MISSION shRNA shRNA Plasmid DNA
Ellis van Creveld syndrome 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4267s1c1
Sequence:CCGGGCAGAAACCATTGATCTATTACTCGAGTAATAGATCAATGGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-922s1c1
Sequence:CCGGCCTATAACACACCGCCTGTATCTCGAGATACAGGCGGTGTGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4171s1c1
Sequence:CCGGCCTCTCAGAGAGAGGATGATACTCGAGTATCATCCTCTCTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-1560s1c1
Sequence:CCGGCCTTTCCCTTAACGACCAAATCTCGAGATTTGGTCGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147127.4-1052s21c1
Sequence:CCGGGACATCGGGTTTGGCAGTATGCTCGAGCATACTGCCAAACCCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147127.4-4179s21c1
Sequence:CCGGCCATATCACAAGGACATAAACCTCGAGGTTTATGTCCTTGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147127
EVC2 MISSION shRNA Lentiviral Transduction Particles
Ellis van Creveld syndrome 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4267s1c1
Sequence:CCGGGCAGAAACCATTGATCTATTACTCGAGTAATAGATCAATGGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-922s1c1
Sequence:CCGGCCTATAACACACCGCCTGTATCTCGAGATACAGGCGGTGTGTTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-4171s1c1
Sequence:CCGGCCTCTCAGAGAGAGGATGATACTCGAGTATCATCCTCTCTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147127.2-1560s1c1
Sequence:CCGGCCTTTCCCTTAACGACCAAATCTCGAGATTTGGTCGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147127.4-1052s21c1
Sequence:CCGGGACATCGGGTTTGGCAGTATGCTCGAGCATACTGCCAAACCCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147127.4-4179s21c1
Sequence:CCGGCCATATCACAAGGACATAAACCTCGAGGTTTATGTCCTTGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks