EMAIL THIS PAGE TO A FRIEND

EVC

Ellis van Creveld syndrome

62 Gene Product Result for
Synonyms: DWF-1 EVC1 EVCL
UniProtKB ID: P57679
Gene ID:
Human(2121) Summary: This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
Mouse(59056) Ellis van Creveld gene syndrome
Rat(289712) Ellis van Creveld syndrome
sheep(101113496) Ellis van Creveld syndrome
domestic guinea pig(100731437) Ellis van Creveld syndrome
naked mole-rat(101719227) Ellis van Creveld syndrome
chicken(422851) Ellis van Creveld syndrome
cow(282874) Ellis van Creveld syndrome
Horse(100070005) Ellis van Creveld syndrome
domestic cat(101092515) Ellis van Creveld syndrome
dog(611166) Ellis van Creveld syndrome
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042981 MISSION® esiRNA esiRNA targeting mouse Evc (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153717 Rosetta Predictions human pricing
XM_001056511 Rosetta Predictions rat pricing
XM_223512 Rosetta Predictions rat pricing
NM_021292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023280 predicted 1139
2 SASI_Hs01_00023282 predicted 1230
3 SASI_Hs02_00367445 predicted 1157
4 SASI_Hs02_00367446 predicted 1155
5 SASI_Hs01_00023286 predicted 1494
6 SASI_Hs01_00023287 predicted 1499
7 SASI_Hs01_00023288 predicted 1005
8 SASI_Hs01_00023289 predicted 1837
9 SASI_Hs02_00367447 predicted 1238
10 SASI_Hs02_00367448 predicted 1012
11 SASI_Hs01_00023281 predicted 350
12 SASI_Hs01_00023283 predicted 945
13 SASI_Hs01_00023284 predicted 948
14 SASI_Hs01_00023285 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283456 predicted 872
2 SASI_Rn02_00283457 predicted 673
3 SASI_Rn02_00283458 predicted 2408
4 SASI_Rn02_00283459 predicted 1062
5 SASI_Rn02_00283460 predicted 1376
6 SASI_Rn02_00283461 predicted 400
7 SASI_Rn02_00283462 predicted 946
8 SASI_Rn02_00283463 predicted 2357
9 SASI_Rn02_00283464 predicted 288
10 SASI_Rn02_00283465 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381447 predicted 2082
2 SASI_Rn02_00381448 predicted 2407
3 SASI_Rn02_00381449 predicted 1318
4 SASI_Rn02_00381450 predicted 1374
5 SASI_Rn02_00381451 predicted 2533
6 SASI_Rn02_00381452 predicted 2358
7 SASI_Rn02_00381453 predicted 1745
8 SASI_Rn02_00381454 predicted 2633
9 SASI_Rn02_00381455 predicted 2391
10 SASI_Rn02_00381456 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071951 predicted 3171
2 SASI_Mm01_00071952 predicted 2393
3 SASI_Mm01_00071953 predicted 2314
4 SASI_Mm01_00071955 predicted 3046
5 SASI_Mm01_00071956 predicted 901
6 SASI_Mm01_00071957 predicted 2524
7 SASI_Mm01_00071958 predicted 3065
8 SASI_Mm01_00071959 predicted 1055
9 SASI_Mm01_00071960 predicted 1923
10 SASI_Mm02_00325822 predicted 380
11 SASI_Mm01_00071954 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014556
EVC MISSION shRNA Bacterial Glycerol Stock
Ellis van Creveld syndrome
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014556.2-5011s1c1
Sequence:CCGGCCTGGTCTAATCCAGGACATACTCGAGTATGTCCTGGATTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-2554s1c1
Sequence:CCGGGCAGGCGTATTACCAGCAAATCTCGAGATTTGCTGGTAATACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-501s1c1
Sequence:CCGGCCAACAGCAATATCACAGCATCTCGAGATGCTGTGATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-1160s1c1
Sequence:CCGGCACTTTCTTGTGGACCAGTTTCTCGAGAAACTGGTCCACAAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-3124s1c1
Sequence:CCGGGAACTCAAAGAAGATGCTAAACTCGAGTTTAGCATCTTCTTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014556
EVC MISSION shRNA shRNA Plasmid DNA
Ellis van Creveld syndrome
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014556.2-5011s1c1
Sequence:CCGGCCTGGTCTAATCCAGGACATACTCGAGTATGTCCTGGATTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-2554s1c1
Sequence:CCGGGCAGGCGTATTACCAGCAAATCTCGAGATTTGCTGGTAATACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-501s1c1
Sequence:CCGGCCAACAGCAATATCACAGCATCTCGAGATGCTGTGATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-1160s1c1
Sequence:CCGGCACTTTCTTGTGGACCAGTTTCTCGAGAAACTGGTCCACAAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-3124s1c1
Sequence:CCGGGAACTCAAAGAAGATGCTAAACTCGAGTTTAGCATCTTCTTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014556
EVC MISSION shRNA Lentiviral Transduction Particles
Ellis van Creveld syndrome
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014556.2-5011s1c1
Sequence:CCGGCCTGGTCTAATCCAGGACATACTCGAGTATGTCCTGGATTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-2554s1c1
Sequence:CCGGGCAGGCGTATTACCAGCAAATCTCGAGATTTGCTGGTAATACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-501s1c1
Sequence:CCGGCCAACAGCAATATCACAGCATCTCGAGATGCTGTGATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-1160s1c1
Sequence:CCGGCACTTTCTTGTGGACCAGTTTCTCGAGAAACTGGTCCACAAGAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014556.2-3124s1c1
Sequence:CCGGGAACTCAAAGAAGATGCTAAACTCGAGTTTAGCATCTTCTTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021292
VALIDATED
EVC MISSION shRNA Bacterial Glycerol Stock
Ellis van Creveld syndrome
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2313s1c1
Sequence:CCGGCTGGTACATGCTAGGAATGTTCTCGAGAACATTCCTAGCATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2310s1c1
Sequence:CCGGCTGCTGGTACATGCTAGGAATCTCGAGATTCCTAGCATGTACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-231s1c1
Sequence:CCGGGATGACAGGAAACGTCTGCTTCTCGAGAAGCAGACGTTTCCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-849s1c1
Sequence:CCGGGTTCTTTCCAAACAAGAGCATCTCGAGATGCTCTTGTTTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-759s1c1
Sequence:CCGGGAGAAGCACCTGATGTTCATTCTCGAGAATGAACATCAGGTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021292
VALIDATED
EVC MISSION shRNA shRNA Plasmid DNA
Ellis van Creveld syndrome
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2313s1c1
Sequence:CCGGCTGGTACATGCTAGGAATGTTCTCGAGAACATTCCTAGCATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2310s1c1
Sequence:CCGGCTGCTGGTACATGCTAGGAATCTCGAGATTCCTAGCATGTACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-231s1c1
Sequence:CCGGGATGACAGGAAACGTCTGCTTCTCGAGAAGCAGACGTTTCCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-849s1c1
Sequence:CCGGGTTCTTTCCAAACAAGAGCATCTCGAGATGCTCTTGTTTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-759s1c1
Sequence:CCGGGAGAAGCACCTGATGTTCATTCTCGAGAATGAACATCAGGTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021292
VALIDATED
EVC MISSION shRNA Lentiviral Transduction Particles
Ellis van Creveld syndrome
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2313s1c1
Sequence:CCGGCTGGTACATGCTAGGAATGTTCTCGAGAACATTCCTAGCATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021292.1-2310s1c1
Sequence:CCGGCTGCTGGTACATGCTAGGAATCTCGAGATTCCTAGCATGTACCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-231s1c1
Sequence:CCGGGATGACAGGAAACGTCTGCTTCTCGAGAAGCAGACGTTTCCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-849s1c1
Sequence:CCGGGTTCTTTCCAAACAAGAGCATCTCGAGATGCTCTTGTTTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021292.1-759s1c1
Sequence:CCGGGAGAAGCACCTGATGTTCATTCTCGAGAATGAACATCAGGTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks