EMAIL THIS PAGE TO A FRIEND

EVI2A

ecotropic viral integration site 2A

72 Gene Product Result for
Synonyms: EVDA EVI-2A EVI2
UniProtKB ID: P22794, B2R5X2, B4DHX8
Gene ID:
Mouse(14017) ecotropic viral integration site 2a
Rat(685433) ecotropic viral integration site 2A
sheep(101101901) ecotropic viral integration site 2A
domestic guinea pig(101788925) ecotropic viral integration site 2A
naked mole-rat(101716967) ecotropic viral integration site 2A
chicken(776037) ecotropic viral integration site 2A
domestic cat(101089055) ecotropic viral integration site 2A
cow(528920) ecotropic viral integration site 2A
dog(100688963) ecotropic viral integration site 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003927 Rosetta Predictions human pricing
NM_014210 Rosetta Predictions human pricing
NM_001044287 Rosetta Predictions rat pricing
NM_001033711 Rosetta Predictions mouse pricing
NM_010161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186667 predicted 1108
2 SASI_Hs01_00186668 predicted 1339
3 SASI_Hs01_00186669 predicted 1319
4 SASI_Hs01_00186670 predicted 1076
5 SASI_Hs01_00186672 predicted 882
6 SASI_Hs01_00186674 predicted 1217
7 SASI_Hs01_00186675 predicted 1083
8 SASI_Hs02_00304421 predicted 1047
9 SASI_Hs02_00304422 predicted 1316
10 SASI_Hs02_00304423 predicted 1347
11 SASI_Hs01_00186671 predicted 930
12 SASI_Hs01_00186673 predicted 550
13 SASI_Hs01_00186676 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233896 predicted 970
2 SASI_Hs01_00233897 predicted 1198
3 SASI_Hs01_00233898 predicted 1177
4 SASI_Hs01_00233899 predicted 938
5 SASI_Hs01_00233901 predicted 737
6 SASI_Hs01_00233902 predicted 409
7 SASI_Hs01_00233903 predicted 1081
8 SASI_Hs01_00233904 predicted 939
9 SASI_Hs01_00233905 predicted 414
10 SASI_Hs02_00345234 predicted 520
11 SASI_Hs01_00233900 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205544 predicted 355
2 SASI_Rn02_00205545 predicted 217
3 SASI_Rn02_00205546 predicted 526
4 SASI_Rn02_00205547 predicted 318
5 SASI_Rn02_00205548 predicted 504
6 SASI_Rn02_00205549 predicted 497
7 SASI_Rn02_00205550 predicted 345
8 SASI_Rn02_00205551 predicted 286
9 SASI_Rn02_00205552 predicted 582
10 SASI_Rn02_00205553 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191182 predicted 1888
2 SASI_Mm01_00191183 predicted 1912
3 SASI_Mm01_00191184 predicted 1747
4 SASI_Mm01_00191185 predicted 1832
5 SASI_Mm01_00191186 predicted 1957
6 SASI_Mm01_00191187 predicted 1981
7 SASI_Mm01_00191188 predicted 1592
8 SASI_Mm01_00191189 predicted 1988
9 SASI_Mm01_00191190 predicted 1856
10 SASI_Mm01_00191191 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123512 predicted 1076
2 SASI_Mm01_00123513 predicted 1096
3 SASI_Mm01_00123514 predicted 940
4 SASI_Mm01_00123515 predicted 1017
5 SASI_Mm01_00123516 predicted 1146
6 SASI_Mm01_00123517 predicted 1171
7 SASI_Mm01_00123518 predicted 785
8 SASI_Mm01_00123519 predicted 1175
9 SASI_Mm01_00123520 predicted 1044
10 SASI_Mm01_00123521 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003927
EVI2A MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 2A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003927.2-1163s21c1
Sequence:CCGGATGAAGTCAGTTGGTATTTAACTCGAGTTAAATACCAACTGACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003927.2-798s21c1
Sequence:CCGGACAACATGGCTATGCTAATTTCTCGAGAAATTAGCATAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003927.1-1448s1c1
Sequence:CCGGGCCAAGTATATGCTTTAACATCTCGAGATGTTAAAGCATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-588s1c1
Sequence:CCGGCCTGAAACATCTCACATCGTACTCGAGTACGATGTGAGATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-327s1c1
Sequence:CCGGGCCCTACCTATACTAGCTAGACTCGAGTCTAGCTAGTATAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-400s1c1
Sequence:CCGGCCTTTCTGATGACAACAGTTTCTCGAGAAACTGTTGTCATCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-328s1c1
Sequence:CCGGCCCTACCTATACTAGCTAGATCTCGAGATCTAGCTAGTATAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003927
EVI2A MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 2A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003927.2-1163s21c1
Sequence:CCGGATGAAGTCAGTTGGTATTTAACTCGAGTTAAATACCAACTGACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003927.2-798s21c1
Sequence:CCGGACAACATGGCTATGCTAATTTCTCGAGAAATTAGCATAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003927.1-1448s1c1
Sequence:CCGGGCCAAGTATATGCTTTAACATCTCGAGATGTTAAAGCATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-588s1c1
Sequence:CCGGCCTGAAACATCTCACATCGTACTCGAGTACGATGTGAGATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-327s1c1
Sequence:CCGGGCCCTACCTATACTAGCTAGACTCGAGTCTAGCTAGTATAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-400s1c1
Sequence:CCGGCCTTTCTGATGACAACAGTTTCTCGAGAAACTGTTGTCATCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-328s1c1
Sequence:CCGGCCCTACCTATACTAGCTAGATCTCGAGATCTAGCTAGTATAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003927
EVI2A MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 2A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003927.2-1163s21c1
Sequence:CCGGATGAAGTCAGTTGGTATTTAACTCGAGTTAAATACCAACTGACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003927.2-798s21c1
Sequence:CCGGACAACATGGCTATGCTAATTTCTCGAGAAATTAGCATAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003927.1-1448s1c1
Sequence:CCGGGCCAAGTATATGCTTTAACATCTCGAGATGTTAAAGCATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-588s1c1
Sequence:CCGGCCTGAAACATCTCACATCGTACTCGAGTACGATGTGAGATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-327s1c1
Sequence:CCGGGCCCTACCTATACTAGCTAGACTCGAGTCTAGCTAGTATAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-400s1c1
Sequence:CCGGCCTTTCTGATGACAACAGTTTCTCGAGAAACTGTTGTCATCAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003927.1-328s1c1
Sequence:CCGGCCCTACCTATACTAGCTAGATCTCGAGATCTAGCTAGTATAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033711
EVI2A MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033711.1-2162s1c1
Sequence:CCGGGCTATCTTAGTACAGCTAATACTCGAGTATTAGCTGTACTAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1358s1c1
Sequence:CCGGCCTTCAGAAACAGTTCTCCAACTCGAGTTGGAGAACTGTTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1227s1c1
Sequence:CCGGTCCGAGTGACAATAACACAAACTCGAGTTTGTGTTATTGTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1586s1c1
Sequence:CCGGACGGTGACTTTCTGGCAAGTACTCGAGTACTTGCCAGAAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1447s1c1
Sequence:CCGGGCCATGCTAATTTGCTTAATTCTCGAGAATTAAGCAAATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033711
EVI2A MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033711.1-2162s1c1
Sequence:CCGGGCTATCTTAGTACAGCTAATACTCGAGTATTAGCTGTACTAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1358s1c1
Sequence:CCGGCCTTCAGAAACAGTTCTCCAACTCGAGTTGGAGAACTGTTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1227s1c1
Sequence:CCGGTCCGAGTGACAATAACACAAACTCGAGTTTGTGTTATTGTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1586s1c1
Sequence:CCGGACGGTGACTTTCTGGCAAGTACTCGAGTACTTGCCAGAAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1447s1c1
Sequence:CCGGGCCATGCTAATTTGCTTAATTCTCGAGAATTAAGCAAATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033711
EVI2A MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033711.1-2162s1c1
Sequence:CCGGGCTATCTTAGTACAGCTAATACTCGAGTATTAGCTGTACTAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1358s1c1
Sequence:CCGGCCTTCAGAAACAGTTCTCCAACTCGAGTTGGAGAACTGTTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1227s1c1
Sequence:CCGGTCCGAGTGACAATAACACAAACTCGAGTTTGTGTTATTGTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1586s1c1
Sequence:CCGGACGGTGACTTTCTGGCAAGTACTCGAGTACTTGCCAGAAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033711.1-1447s1c1
Sequence:CCGGGCCATGCTAATTTGCTTAATTCTCGAGAATTAAGCAAATTAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks