EMAIL THIS PAGE TO A FRIEND

EVI2B

ecotropic viral integration site 2B

48 Gene Product Result for
Synonyms: CD361 D17S376 EVDB
UniProtKB ID: P34910
Gene ID:
Mouse(216984) ecotropic viral integration site 2b
Rat(100910940) ecotropic viral integration site 2B
sheep(101123474) ecotropic viral integration site 2B
naked mole-rat(101717545) ecotropic viral integration site 2B
domestic guinea pig(100730082) ecotropic viral integration site 2B
chicken(776032) ecotropic viral integration site 2B
cow(617442) ecotropic viral integration site 2B
domestic cat(101088793) ecotropic viral integration site 2B
dog(610438) ecotropic viral integration site 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034811 MISSION® esiRNA esiRNA human EVI2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006495 Rosetta Predictions human pricing
NM_001077496 Rosetta Predictions mouse pricing
NM_146023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093524 predicted 768
2 SASI_Hs02_00341695 predicted 1189
3 SASI_Hs02_00341696 predicted 351
4 SASI_Hs01_00093525 predicted 532
5 SASI_Hs01_00093526 predicted 818
6 SASI_Hs01_00093528 predicted 469
7 SASI_Hs01_00093529 predicted 1016
8 SASI_Hs01_00093530 predicted 1289
9 SASI_Hs01_00093531 predicted 879
10 SASI_Hs01_00093532 predicted 1301
11 SASI_Hs01_00093527 predicted 764
12 SASI_Hs01_00093533 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292692 predicted 1024
2 SASI_Mm02_00292693 predicted 1041
3 SASI_Mm02_00292694 predicted 919
4 SASI_Mm02_00292695 predicted 223
5 SASI_Mm02_00292696 predicted 253
6 SASI_Mm02_00292697 predicted 421
7 SASI_Mm02_00292698 predicted 1048
8 SASI_Mm02_00292699 predicted 1235
9 SASI_Mm02_00292700 predicted 399
10 SASI_Mm02_00292701 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112464 predicted 1442
2 SASI_Mm01_00112465 predicted 1459
3 SASI_Mm01_00112466 predicted 1336
4 SASI_Mm01_00112467 predicted 637
5 SASI_Mm01_00112468 predicted 668
6 SASI_Mm01_00112469 predicted 835
7 SASI_Mm01_00112470 predicted 1463
8 SASI_Mm01_00112471 predicted 1643
9 SASI_Mm01_00112472 predicted 807
10 SASI_Mm01_00112473 predicted 1632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006495
EVI2B MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-431s1c1
Sequence:CCGGCACCAAACAACCAACACCAATCTCGAGATTGGTGTTGGTTGTTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1209s1c1
Sequence:CCGGCCTCTTCCAAATGATTCTACTCTCGAGAGTAGAATCATTTGGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-229s1c1
Sequence:CCGGCATCATCAATGTCACAGGTATCTCGAGATACCTGTGACATTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-211s1c1
Sequence:CCGGCACAGCCTACCTTATTCACATCTCGAGATGTGAATAAGGTAGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1066s1c1
Sequence:CCGGCAGAAGATAGTGCTGATGGTTCTCGAGAACCATCAGCACTATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1175s1c1
Sequence:CCGGCCAATCTGACAAACCCACAATCTCGAGATTGTGGGTTTGTCAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-321s1c1
Sequence:CCGGCAATCAATATCACCTGCCAAACTCGAGTTTGGCAGGTGATATTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1405s1c1
Sequence:CCGGCCAACTCTGATCAAGATCTTACTCGAGTAAGATCTTGATCAGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006495.2-1595s1c1
Sequence:CCGGGAGCCTATGTGCATAGATGAACTCGAGTTCATCTATGCACATAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-923s1c1
Sequence:CCGGCATTTCACTTACACCCTGGAACTCGAGTTCCAGGGTGTAAGTGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006495
EVI2B MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-431s1c1
Sequence:CCGGCACCAAACAACCAACACCAATCTCGAGATTGGTGTTGGTTGTTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1209s1c1
Sequence:CCGGCCTCTTCCAAATGATTCTACTCTCGAGAGTAGAATCATTTGGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-229s1c1
Sequence:CCGGCATCATCAATGTCACAGGTATCTCGAGATACCTGTGACATTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-211s1c1
Sequence:CCGGCACAGCCTACCTTATTCACATCTCGAGATGTGAATAAGGTAGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1066s1c1
Sequence:CCGGCAGAAGATAGTGCTGATGGTTCTCGAGAACCATCAGCACTATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1175s1c1
Sequence:CCGGCCAATCTGACAAACCCACAATCTCGAGATTGTGGGTTTGTCAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-321s1c1
Sequence:CCGGCAATCAATATCACCTGCCAAACTCGAGTTTGGCAGGTGATATTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1405s1c1
Sequence:CCGGCCAACTCTGATCAAGATCTTACTCGAGTAAGATCTTGATCAGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006495.2-1595s1c1
Sequence:CCGGGAGCCTATGTGCATAGATGAACTCGAGTTCATCTATGCACATAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-923s1c1
Sequence:CCGGCATTTCACTTACACCCTGGAACTCGAGTTCCAGGGTGTAAGTGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006495
EVI2B MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-431s1c1
Sequence:CCGGCACCAAACAACCAACACCAATCTCGAGATTGGTGTTGGTTGTTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1209s1c1
Sequence:CCGGCCTCTTCCAAATGATTCTACTCTCGAGAGTAGAATCATTTGGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-229s1c1
Sequence:CCGGCATCATCAATGTCACAGGTATCTCGAGATACCTGTGACATTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-211s1c1
Sequence:CCGGCACAGCCTACCTTATTCACATCTCGAGATGTGAATAAGGTAGGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006495.2-1066s1c1
Sequence:CCGGCAGAAGATAGTGCTGATGGTTCTCGAGAACCATCAGCACTATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1175s1c1
Sequence:CCGGCCAATCTGACAAACCCACAATCTCGAGATTGTGGGTTTGTCAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-321s1c1
Sequence:CCGGCAATCAATATCACCTGCCAAACTCGAGTTTGGCAGGTGATATTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-1405s1c1
Sequence:CCGGCCAACTCTGATCAAGATCTTACTCGAGTAAGATCTTGATCAGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006495.2-1595s1c1
Sequence:CCGGGAGCCTATGTGCATAGATGAACTCGAGTTCATCTATGCACATAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006495.2-923s1c1
Sequence:CCGGCATTTCACTTACACCCTGGAACTCGAGTTCCAGGGTGTAAGTGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146023
EVI2B MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 2B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1168s1c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-639s1c1
Sequence:CCGGGCAGCAATCACTGTCTACTTTCTCGAGAAAGTAGACAGTGATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1166s1c1
Sequence:CCGGCTGCCATATTAATCGGTACTACTCGAGTAGTACCGATTAATATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1197s21c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1046s21c1
Sequence:CCGGAGAAGTAGAGTCTACTCATAACTCGAGTTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.3-1047s1c1
Sequence:CCGGGAAGTAGAGTCTACTCATAATCTCGAGATTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-942s21c1
Sequence:CCGGCCATCACCTTCTACCTATAATCTCGAGATTATAGGTAGAAGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-687s21c1
Sequence:CCGGTTAATCACACCGTCGTTATATCTCGAGATATAACGACGGTGTGATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146023.3-2053s21c1
Sequence:CCGGCCCACGTACACGGGTAGATTACTCGAGTAATCTACCCGTGTACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146023
EVI2B MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 2B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1168s1c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-639s1c1
Sequence:CCGGGCAGCAATCACTGTCTACTTTCTCGAGAAAGTAGACAGTGATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1166s1c1
Sequence:CCGGCTGCCATATTAATCGGTACTACTCGAGTAGTACCGATTAATATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1197s21c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1046s21c1
Sequence:CCGGAGAAGTAGAGTCTACTCATAACTCGAGTTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.3-1047s1c1
Sequence:CCGGGAAGTAGAGTCTACTCATAATCTCGAGATTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-942s21c1
Sequence:CCGGCCATCACCTTCTACCTATAATCTCGAGATTATAGGTAGAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-687s21c1
Sequence:CCGGTTAATCACACCGTCGTTATATCTCGAGATATAACGACGGTGTGATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146023.3-2053s21c1
Sequence:CCGGCCCACGTACACGGGTAGATTACTCGAGTAATCTACCCGTGTACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146023
EVI2B MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 2B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1168s1c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-639s1c1
Sequence:CCGGGCAGCAATCACTGTCTACTTTCTCGAGAAAGTAGACAGTGATTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.2-1166s1c1
Sequence:CCGGCTGCCATATTAATCGGTACTACTCGAGTAGTACCGATTAATATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1197s21c1
Sequence:CCGGGCCATATTAATCGGTACTATTCTCGAGAATAGTACCGATTAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-1046s21c1
Sequence:CCGGAGAAGTAGAGTCTACTCATAACTCGAGTTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146023.3-1047s1c1
Sequence:CCGGGAAGTAGAGTCTACTCATAATCTCGAGATTATGAGTAGACTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-942s21c1
Sequence:CCGGCCATCACCTTCTACCTATAATCTCGAGATTATAGGTAGAAGGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146023.3-687s21c1
Sequence:CCGGTTAATCACACCGTCGTTATATCTCGAGATATAACGACGGTGTGATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146023.3-2053s21c1
Sequence:CCGGCCCACGTACACGGGTAGATTACTCGAGTAATCTACCCGTGTACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)