EMAIL THIS PAGE TO A FRIEND

EVI5

ecotropic viral integration site 5

142 Gene Product Result for
Synonyms: NB4S
UniProtKB ID: O60447, A6NKX8, Q9H1Y9
Gene ID:
Mouse(14020) ecotropic viral integration site 5
Rat(100360066) ecotropic viral integration site 5
sheep(101117131) ecotropic viral integration site 5
Domestic Rabbit(100340590) ecotropic viral integration site 5
domestic guinea pig(100721570) ecotropic viral integration site 5
naked mole-rat(101713895) ecotropic viral integration site 5
fruit fly(32088) CG11727 gene product from transcript CG11727-RA
cow(536706) ecotropic viral integration site 5
Horse(100059782) ecotropic viral integration site 5
domestic cat(101097660) ecotropic viral integration site 5
chicken(424500) ecotropic viral integration site 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005665 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005665 Rosetta Predictions human pricing
NM_007964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067078 predicted 2052
2 SASI_Hs01_00067079 predicted 2106
3 SASI_Hs02_00340041 predicted 1657
4 SASI_Hs01_00067081 predicted 1700
5 SASI_Hs01_00067082 predicted 979
6 SASI_Hs01_00067083 predicted 959
7 SASI_Hs02_00340042 predicted 1682
8 SASI_Hs02_00340043 predicted 469
9 SASI_Hs01_00067084 predicted 624
10 SASI_Hs01_00067085 predicted 234
11 SASI_Hs01_00067080 predicted 480
12 SASI_Hs01_00067086 predicted 555
13 SASI_Hs01_00067087 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312849 predicted 782
2 SASI_Mm01_00175219 predicted 232
3 SASI_Mm01_00175220 predicted 2245
4 SASI_Mm02_00312850 predicted 2056
5 SASI_Mm01_00175221 predicted 748
6 SASI_Mm01_00175222 predicted 1935
7 SASI_Mm01_00175223 predicted 1038
8 SASI_Mm01_00175224 predicted 942
9 SASI_Mm01_00175225 predicted 2157
10 SASI_Mm01_00175227 predicted 2125
11 SASI_Mm01_00175226 predicted 695
12 SASI_Mm01_00175228 predicted 2266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007964
VALIDATED
EVI5 MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-534s21c1
Sequence:CCGGGTGAAGGAGCTTGTTCGTAAACTCGAGTTTACGAACAAGCTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1840s21c1
Sequence:CCGGAGACACAGAACCAGATCAATACTCGAGTATTGATCTGGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1424s21c1
Sequence:CCGGTTCCACCTACAACGAAGATTTCTCGAGAAATCTTCGTTGTAGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-2244s21c1
Sequence:CCGGCACATTGTCAGCCATCTAATACTCGAGTATTAGATGGCTGACAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1522s21c1
Sequence:CCGGAGGATAAAGTGTTGGATATAGCTCGAGCTATATCCAACACTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007964.2-2646s21c1
Sequence:CCGGTGAAGTATGCTAATTGGTAAACTCGAGTTTACCAATTAGCATACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-3907s1c1
Sequence:CCGGCCCGCTAAATTCTTGTATTTACTCGAGTAAATACAAGAATTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1653s1c1
Sequence:CCGGCGACAGCAAGTCAGAACCTTACTCGAGTAAGGTTCTGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1740s1c1
Sequence:CCGGGCTGTGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1626s1c1
Sequence:CCGGGAAGCCATTATGGGTTTGAAACTCGAGTTTCAAACCCATAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1520s1c1
Sequence:CCGGGCAGGATAAAGTGTTGGATATCTCGAGATATCCAACACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007964
VALIDATED
EVI5 MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-534s21c1
Sequence:CCGGGTGAAGGAGCTTGTTCGTAAACTCGAGTTTACGAACAAGCTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1840s21c1
Sequence:CCGGAGACACAGAACCAGATCAATACTCGAGTATTGATCTGGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1424s21c1
Sequence:CCGGTTCCACCTACAACGAAGATTTCTCGAGAAATCTTCGTTGTAGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-2244s21c1
Sequence:CCGGCACATTGTCAGCCATCTAATACTCGAGTATTAGATGGCTGACAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1522s21c1
Sequence:CCGGAGGATAAAGTGTTGGATATAGCTCGAGCTATATCCAACACTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007964.2-2646s21c1
Sequence:CCGGTGAAGTATGCTAATTGGTAAACTCGAGTTTACCAATTAGCATACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-3907s1c1
Sequence:CCGGCCCGCTAAATTCTTGTATTTACTCGAGTAAATACAAGAATTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1653s1c1
Sequence:CCGGCGACAGCAAGTCAGAACCTTACTCGAGTAAGGTTCTGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1740s1c1
Sequence:CCGGGCTGTGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1626s1c1
Sequence:CCGGGAAGCCATTATGGGTTTGAAACTCGAGTTTCAAACCCATAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1520s1c1
Sequence:CCGGGCAGGATAAAGTGTTGGATATCTCGAGATATCCAACACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007964
VALIDATED
EVI5 MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-534s21c1
Sequence:CCGGGTGAAGGAGCTTGTTCGTAAACTCGAGTTTACGAACAAGCTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1840s21c1
Sequence:CCGGAGACACAGAACCAGATCAATACTCGAGTATTGATCTGGTTCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1424s21c1
Sequence:CCGGTTCCACCTACAACGAAGATTTCTCGAGAAATCTTCGTTGTAGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-2244s21c1
Sequence:CCGGCACATTGTCAGCCATCTAATACTCGAGTATTAGATGGCTGACAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007964.2-1522s21c1
Sequence:CCGGAGGATAAAGTGTTGGATATAGCTCGAGCTATATCCAACACTTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007964.2-2646s21c1
Sequence:CCGGTGAAGTATGCTAATTGGTAAACTCGAGTTTACCAATTAGCATACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-3907s1c1
Sequence:CCGGCCCGCTAAATTCTTGTATTTACTCGAGTAAATACAAGAATTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1653s1c1
Sequence:CCGGCGACAGCAAGTCAGAACCTTACTCGAGTAAGGTTCTGACTTGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1740s1c1
Sequence:CCGGGCTGTGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007964.1-1626s1c1
Sequence:CCGGGAAGCCATTATGGGTTTGAAACTCGAGTTTCAAACCCATAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007964.1-1520s1c1
Sequence:CCGGGCAGGATAAAGTGTTGGATATCTCGAGATATCCAACACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005665
VALIDATED
EVI5 MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-67s1c1
Sequence:CCGGCGACAGACAAAGTTGCAGAAACTCGAGTTTCTGCAACTTTGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-517s1c1
Sequence:CCGGGAGCAATAGTTTGGCAACTTTCTCGAGAAAGTTGCCAAACTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1501s1c1
Sequence:CCGGCCCTTCCTGATGAGAATAATACTCGAGTATTATTCTCATCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-1203s1c1
Sequence:CCGGGCTTACCAAGTCCAATACAATCTCGAGATTGTATTGGACTTGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1683s1c1
Sequence:CCGGGCTATGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1920s1c1
Sequence:CCGGGCAGAGATTGAATGCAAGAATCTCGAGATTCTTGCATTCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-441s1c1
Sequence:CCGGGAATGGGAAGATGTACGCAAACTCGAGTTTGCGTACATCTTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2016s1c1
Sequence:CCGGGCTGAGCTTGAAATCCAGAAACTCGAGTTTCTGGATTTCAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-304s1c1
Sequence:CCGGCGGATAGTAAGTCTTTAAGATCTCGAGATCTTAAAGACTTACTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-876s1c1
Sequence:CCGGCTTTGTATGTACCAGTTTGAACTCGAGTTCAAACTGGTACATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1819s1c1
Sequence:CCGGGAGCAGAACAAGAGGTGATTACTCGAGTAATCACCTCTTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2410s1c1
Sequence:CCGGCGAGAAGAAGAGAGTCGTATTCTCGAGAATACGACTCTCTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005665
VALIDATED
EVI5 MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-67s1c1
Sequence:CCGGCGACAGACAAAGTTGCAGAAACTCGAGTTTCTGCAACTTTGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-517s1c1
Sequence:CCGGGAGCAATAGTTTGGCAACTTTCTCGAGAAAGTTGCCAAACTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1501s1c1
Sequence:CCGGCCCTTCCTGATGAGAATAATACTCGAGTATTATTCTCATCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-1203s1c1
Sequence:CCGGGCTTACCAAGTCCAATACAATCTCGAGATTGTATTGGACTTGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1683s1c1
Sequence:CCGGGCTATGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1920s1c1
Sequence:CCGGGCAGAGATTGAATGCAAGAATCTCGAGATTCTTGCATTCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-441s1c1
Sequence:CCGGGAATGGGAAGATGTACGCAAACTCGAGTTTGCGTACATCTTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2016s1c1
Sequence:CCGGGCTGAGCTTGAAATCCAGAAACTCGAGTTTCTGGATTTCAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-304s1c1
Sequence:CCGGCGGATAGTAAGTCTTTAAGATCTCGAGATCTTAAAGACTTACTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-876s1c1
Sequence:CCGGCTTTGTATGTACCAGTTTGAACTCGAGTTCAAACTGGTACATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1819s1c1
Sequence:CCGGGAGCAGAACAAGAGGTGATTACTCGAGTAATCACCTCTTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2410s1c1
Sequence:CCGGCGAGAAGAAGAGAGTCGTATTCTCGAGAATACGACTCTCTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005665
VALIDATED
EVI5 MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-67s1c1
Sequence:CCGGCGACAGACAAAGTTGCAGAAACTCGAGTTTCTGCAACTTTGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-517s1c1
Sequence:CCGGGAGCAATAGTTTGGCAACTTTCTCGAGAAAGTTGCCAAACTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1501s1c1
Sequence:CCGGCCCTTCCTGATGAGAATAATACTCGAGTATTATTCTCATCAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-1203s1c1
Sequence:CCGGGCTTACCAAGTCCAATACAATCTCGAGATTGTATTGGACTTGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1683s1c1
Sequence:CCGGGCTATGAATGAGTTACAGGATCTCGAGATCCTGTAACTCATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005665.2-1920s1c1
Sequence:CCGGGCAGAGATTGAATGCAAGAATCTCGAGATTCTTGCATTCAATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-441s1c1
Sequence:CCGGGAATGGGAAGATGTACGCAAACTCGAGTTTGCGTACATCTTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2016s1c1
Sequence:CCGGGCTGAGCTTGAAATCCAGAAACTCGAGTTTCTGGATTTCAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005665.2-304s1c1
Sequence:CCGGCGGATAGTAAGTCTTTAAGATCTCGAGATCTTAAAGACTTACTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005665.2-876s1c1
Sequence:CCGGCTTTGTATGTACCAGTTTGAACTCGAGTTCAAACTGGTACATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-1819s1c1
Sequence:CCGGGAGCAGAACAAGAGGTGATTACTCGAGTAATCACCTCTTGTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005665.2-2410s1c1
Sequence:CCGGCGAGAAGAAGAGAGTCGTATTCTCGAGAATACGACTCTCTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks